Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Chloroflexia

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Roseiflexus castenholzii DSM 13941
Rcas_2285 gcvT -137 44 CCGACGACCCTCTGGAGAGCCCGTCTATTCGGGCGCCGACGGAGAAACCCGTCATGCGGGGCATCTCACAGGTCAGTGGACAGAGGTCAGGCG
Rcas_2285 gcvT -235 50.1 GATGACGGGCGTGGGAGAGCGCCGCGTAAGCGGTCGCCGAAGGAGCAAGCCAGGGAAGCCGGGCCCTGCGCGAATCTCTCAGGCTGAAGGACTGCGCCC
Roseiflexus sp. RS-1
RoseRS_1526 gcvT -236 52.5 GACGACGGGCGTGGGAGAGAACCGCGCAAGCGGTCGCCGAAGGAGCAAGCCGGGGTTGCCGGACCCTGCGCGAATCTCTCAGGCGAAAGGACTGCGCCC
RoseRS_1526 gcvT -138 53.3 CTGACGACCCTCTGGAGAGCCTGTTCATACGGGCGCCGACGGAGTAACCCGTTATGCGGGGCATCTCTCAGGTCAACGGACAGAGGTCAGGCG
Herpetosiphon aurantiacus ATCC 23779
Haur_2867 lplA -134 59.4 GACAGCGCTCTGGAGAGCAAGCATTCACTTGCACCGATGGAGTAACTTGCAGCGCAAGGAATCTCTCAGGTCAATGGACAGAGATCAGGCATT
Haur_2867 lplA -233 48.9 TGAAGGACGCGGAAGAGTATCCCCACAGGGATCGCCGACGAAGCAAATTACGGGTAGCCAACCCGTTGATGAATCTTTCAGGCTCCAACACCGTGTCTCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD