Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Clostridiaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_3972 aroP -220 52.6 ACCTTGGAGAGACTCGAAAAGAGCACCGAAGGAGAAAGCTGTAAAGGCGAAACTCTCAGGTAAAAGGACAGGG
Cbei_3972 aroP -316 47.2 GATGAAGATAGCGGGAGAGTAATGGCTATGGTCATTCACCGAAGAAGTAAATCTTTCAGGTACCTATTTAATTAGAGATGACCGCTATTGGATG
Cbei_2529 COG2860 -155 39.1 CTGACGAAACTCTGGAAAGTCTTATGACACCCAAGAAGCAATCTTTTTAGTTAACTATTAAAAGAGAATCTTTCAGGTAAAATAACAGAGGCGAATTG
Cbei_2529 COG2860 -237 48.4 TGTGACGAATTTGGGAGATGCTACAAGCAATGTAGAGCCGAAGGTGAAATCGCAACAAACTCTCAGGCAAAGGGACCGAATTC
Clostridium difficile 630
CD2276 glyP -277 65.6 TACGGAACTCTGGAGAGACCCATTATGGGCGCCGAAGGGGCAAGGCTTTTATGCTCAATCTCTCAGGCAAAAGGACAGGGATTATCTACC
CD2276 glyP -358 34.9 AAGATTTTATAGAAGAGTTGCTATATAGCACACCGAAGGAGTAACACTCTCAGGTACTTTTAAAAGTAGGACTGTAAAATTT
CD1657 gcv(T/H/P1) -213 42 GATGGGACTCTGGAGAGACTTAAGTTAAGATACTATAAGTCACCGAAGAAGCAAAATAATATTAAATTATTAAATCTTTCAGGTATACAAACAGGGATATATAGGC
CD1657 gcv(T/H/P1) -313 53 TGAGATTAGCGAGAGAGTCCTTTATACGAAAAGGCGCCGAAGAAGAAATTTAAGAAATGCCAATTTTTAGAGAAGCTTTCAGGCAAAAATATCGCTAATTG
CD2357 grdX -215 47.1 GATGAAGAGTATGGGAGACTGCTTTATAAAAAGCGACCGAAGGGACAAGTTTAATCTTACTTACCCAAAAGATTAGATGAAATTCTCAGGTAAAGGTGACTGTACTTGGACG
Clostridium perfringens ATCC 13124
CPF_1672 glyP -168 72.7 TGGACGAGCCTCTGGAGAGACTCTTTTAAAAAAGAGCACCGAAGGAGCAAGGTCAAATTTTTTGACTGAAACTCTCAGGTAAAAGGACAGAGGATAAGGT
CPF_1672 glyP -242 48.5 GATGAAGGTAATGGGAGAGTGATATTTTAAATATCCACCGAAGAGGGAAATCTTTCAGGTATTAGGACCGTTACT
Clostridium novyi NT
NT01CX_2425 glyP -261 32.8 GATGAAGATAGCGGGAGAGAGATGGGATTCCATCCACCGAAGAGGTCAATCTTTCAGGTAACTATGTTTATAGGGGATGACCGTTATT
NT01CX_2425 glyP -174 66.3 TGGACGAGCCTCTGGAGAGATCCATTAATGGACACCGAAGGAGAAAGATAGCTAAATTTTAGTTATTGAAACTCTCAGGTAAAAGGACAGAGGATAGGAT
Clostridium botulinum A str. ATCC 3502
CBO1255 grdX -159 38.9 GACAAAACTCTGGAAAGCATTACGCACCGAAGGAGCAAAACTCTCAGGTTAAGATACAGAGATAAAAGTTA
CBO1255 grdX -239 20.8 TATCCTTATAGGATAGCCGAAGGAACTAAGTGTTATTCCCATAAATAACATGAATATCTCAGGCAAATGGACC
Clostridium acetobutylicum ATCC 824
CAC1472 aroP -222 53.7 ACCCTTGGAGAGACTCTTAAAGAGCACCGAAGGAGAAAGCATAAAAAAAGCGAAACTCTCAGGTAAAAGGACAGGGG
CAC1472 aroP -317 40.7 GATGAAGTTAGCGGGAGAGCTTTGGCTTTTGCCATACACCGAAGAAGTAAATCTTTCAGGTATCTATTTAATTAGAGATGACCGCTATTGGATG
Clostridium tetani E88
CTC01975 glyP -100 72.4 TGGACGAAACTCTGGAGAGACTCTTTTTTATAAAAGAGCACCGAAGGAGCAAGTTGGGTAAAACCAATGAAACTCTCAGGTAAAAGGACAGAGCGTAGAAG
CTC01813 COG0697 -252 57.3 TGAAGAGTATAAGAGAGATCCTATTTTAAAGGACGCCGAAGGGACAATCTATGTTTATCCCAATAAAACATAGAGAAATTCTCAGGCAAAAGAATTATACTTTGATAGA
CTC01975 glyP -186 35.3 GATGAAGGTAATAGGAGAGAGGTCTTTTGACCCACCGAAGATGCAAAAATCTTTCAGGTACCATTGTTTATGGCGAGGACTGTTATT
Clostridium cellulolyticum H10
Ccel_1188 serC -323 45.5 TGATTGTTGTGGGAGAGATGTTTTAGAATTCTAAAACTCACCGAAGGAGTAGCACTCTCAGGTAAAAAGACTACAACAGG
Ccel_1188 serC -244 58.8 GACGGACCTCTGGAGAGACCAATGACGGCGCCGAAGGGGCAAAGGCTAGTTAAATTTAGCTTAATCTCTCAGGCAAAAGGACAGAGTATCTAAAAG
Clostridium kluyveri DSM 555
CKL_1774 gcvT -128 34.1 TTGACGAAACTCTGGAAAGTAGCAATACACCGAAGAAGCTAAAATCTTTCAGGTATAAAAGACAGAGCGCATAAA
CKL_0776 gcvR -229 61.4 TGGACGAACCTCTGGAGAGACTCTTTAAGAGCACCGAAGGGGAAAGCCAAAATTTTGGTGAAACTCTCAGGTAAAAAGGACAGGGGATTTCAT
CKL_1774 gcvT -213 55.8 AATGATAAATTTAGGAGAGACTGCCAGAAATATGGCGGCACCGAAGGGGAAGCTGCAGTAAACTCTCAGGTAAAAGGACTGAATTT
CKL_3526 aroP -373 51.8 ATCCTTGGAGAGACTCTTAATGAGCACCGAAGGAGAAAGTCGAAGGGCGAAACTCTCAGGTAAAAGGACAGGGA
CKL_3526 aroP -469 38.7 GATGAAAATAGTGGGAGAGTTATGGCAATAGCCATTCACCGAAGAAGTAAATCTTTCAGGTACCTATTTAATTTAGAGATGACCGCTATTGGATG
Clostridium sp. OhILAs
Clos_0953 grdX -194 40.5 GACGGTACTCTGAAAAGCTGATTTAGCACCGACGGGGCAATTTCTATAGAATATAGAAGGAAACTCTCAGGTTAATGAACAGAGCAACTAATGC
Clos_0065 gcvT -468 49.4 TGAAAATAACGAGAGATATTCTTACTGGAATAGCCGAAGAAGCAATATAGAAGATGCCATTCTTCCATAGAATCTTTCAGGCAAAAGGATCGTTATTGG
Clos_0065 gcvT -370 57.9 GATGAATCTCTGGAGAGACCGTAAACGCGGCGCCGTAGGAGAAATACTTTTTAGTGTAGAAACTCTCAGGCACAAATACAGAGGAGCATGATG
Clos_0953 grdX -298 52.6 AGAAGAGTGCGGGAGAGATTTAGCGTGACTGCTAAACGCCGAAGGAAGAAGCTGAAAAGTTCGCCGCTTTTTAGTGAAGATCTCAGGCAAAAGGACCGTACTTGG
Clostridium bartlettii DSM 16795
CLOBAR_02646 glyP -264 67.6 TAGGATACTCTGGAGAGACCTTTTTGATAAGGCGCCGAAGGGGCAAAAGCTATTAGCTAGCTCAATCTCTCAGGCAAAAGGACAGAGCTTTAACCGG
CLOBAR_00195 potE -266 47.1 TGAAATTTATGGGAGAGATTTCTAAATTTTAGAAACACCGATGGGGCAATTGATAAAATATCACAGTTTTATCAAGAAACTTTCAGGTAAAAAGACTATAAATGGATAGA
CLOBAR_02646 glyP -349 38.8 GAAACTTTACAGAAGAGTTGTCAATATGACACACCGAAGGAGTAACGCTCTCAGGTACTTTATTTTAAAGTGGGACTGTAATGTAT
Clostridium bolteae ATCC BAA-613
CLOBOL_01537 gcvT -125 39.8 CGGACGATACTCTGGAGAGCATAGCACCGAAGAAGCCAAATCTTTCAGGTCCAAGGACAGAGCGCATGAA
CLOBOL_01537 gcvT -265 39.7 GAAGATGGATTCGGGAGAGACTGACCAAAATGTATGAAAGATACAGAATACGCTTGATATAGCGTATCCGTGTATTATCAGCATACAGAACACAGCGCCGAAGGGGAAGCGGAAAACTCTCAGGCAAAAGGACCGGATACC
CLOBOL_05294 glyA2 -349 47.8 TGATGGATTCGGGAGAGACTGCACAGGCAGCGCCGAAGGGGAAGCGAAGAACTCTCAGGCAAAAGAACCGGATACTGG
CLOBOL_05294 glyA2 -272 34 GACGAAACTCTGGAAAGCGATAGCACCGACGAAGCCAAATCTTTCAGGTACAAAGACAGAGCGCATGAACA
CLOBOL_00277 pfoR -386 49.2 CGGACGGGACTCTGGAGAAGGTCACTAAAATGTGAATACCGATGAAGCAACCGGCGGCATAGCAGCAACCGCGTCAGGGAAACTTTCAGGTAAAAGGACAGAGGCAGACAT
CLOBOL_00277 pfoR -463 49.8 GTTGATGAATTCGGGAGAGATTACCGCCAGGTAACGCCGAAGGGGATGCGCAAACTCTCAGGCAAAAGAATCGAATTC
Clostridium butyricum 5521
CBY_0150 glyP -425 46.5 GATGAAGATGGTGGGAGAGATATCATTTTATATTATTAATATTAAAATGATACACCGAAGAGGGAAATCTTTCAGGTATTAGGACCGCCATTGGACG
CBY_0150 glyP -327 56.8 GCCTCTGGAGAGACTTATTTAATAAGCACCGAAGGAGCAAGGTTGTATACAATACGTGTACAATTGAAACTCTCAGGTAAAAGGACAGGGG
Clostridium hiranonis DSM 13275
CLOHIR_00302 COG1748 -318 31.4 TGAGGACTGCATTAGAGACTTTTTAAATGAAGCGCCGAAGAAGCAAAACAGAAATTTCATCTTGTTTCTGTGGAAACTGACAGGCAAAAGGAGGGCAGTCTG
CLOHIR_00302 COG1748 -217 27.5 GACGATACTTTGGAGAGAGTGATTTAATTCACCGCCTACGAGGATATAACCAACTGGCAAAAGGACAGAGATATAGATGC
CLOHIR_00161 grdX -185 34 TGAAGCGTATAGGAGACTTCCTTAAATGGGGACCGAAGGTACAAATGTTTACTATTACCCGATAGTAAATGTGAAATTCTCAGGTGAATATACTATATGGCGG
CLOHIR_02272 alsT -204 63.4 TTAGGAACTCTGGAGAGTCTCCAAAAAAGGGGCGCCGAAGGTGTACGCAAACTAAGTTTGCAAATCTCTCAGGCAAAAGGACAGAGCAGTAAGGCA
Clostridium leptum DSM 753
CLOLEP_01924 glyP -122 58.7 GGCGACTCTCTGGAGAGTCCCGGTTTTCGGGAGCCGAAGGTGTAAGGCGGAGCTTCCGCTGATCTCTCAGGCAAAAGGACAGAGGACACAAATG
Clostridium nexile DSM 1787
CLONEX_04109 alsT -187 51.2 TTAAAAAAACTCTGGAGAGTCTCAAATATTAGAGCGCCGAAGGTGTACGGCAGACAGAAATGTCTGTTAATCTCTCAGGCAAAAGGACAGGGCAAATGTA
Clostridium scindens ATCC 35704
CLOSCI_00442 potE -198 30.2 GAAGTAGCGAGGAAGATTTCCGTATGTTAGCACACGGAAAACCGATGAAGCAATCAGAGAGGCTCCTAACCGCTCTGAGAAACTTTCAGGTGCCAATACCCGCTATGG
CLOSCI_00442 potE -91 48.5 GATGGGACTCTGGAAAGAGCCTTTTCGATAAGGCCACCGTAGAAGTAAAACTTTCAGGTAAAAATACAGAGGGTACAGGAC
CLOSCI_00776 grdX -205 58.5 ATGATGTTTCTCAAGAGAGAGTTGGAATATCCAACCGCCGAAGAGGCAAGCCGGGCGTATGATGGTGAGCGCATGCAAGGTGAAACTTTCAGGCAAAAGGACTGGGAAACGTAC
Clostridium sp. SS2/1
CLOSS21_00738 glyP -216 61.5 AGAAATGAACTCTGGAGAGTCTCATAAGTGAGCGCCGAAGGTGTACAGTTTCTATTAGGAAACTAATCTCTCAGGCAAAAGGACAGAGCTTTATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD