Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Clostridiaceae

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_0874 Cbei_0874 -433 65.2 ATATCAATAGGCACACTTATTGAAAAATAGGGTCGCAAAGCTATGAGTCTAAGGAAAAATTTAATTTTCTATGATTGTCAGGTTGCCAAAAT
Cbei_4273 motA -260 68.6 TAAATGTTACTAGCACACTTATTGAAAGATAAGGCCGCAAAGCCATGAGTCTAAGGGAATTTACATTTCTATGATTGTCAGGTTGCCAAA
Cbei_4033 null -229 71.8 GTATTGATAATAGCACACTTGCCGAAAGGTAGGGCCGCAAAGCTATGGGTCTAAAGAAATTCATTTTCAATGATTGCCAGGTTGCCAAA
Cbei_0537 cheY -120 62.2 TATTGAATTGGCAAAGCAGTTGAAAAACTGTGACGCAAAGCTAGAGGGCCTTTTCCTTTTGAAAGGATGGCAGCCAGTTGCAAGTCT
Clostridium bolteae ATCC BAA-613
CLOBOL_00225 null -394 53.7 AAAAAATAATTAGCAAAACTGGTGAAAGCTAGTGACGCAAAGCTACAGGGATTTCTCTCTAAAAAGAGGTGTCAGCCAGCTGCATGA
CLOBOL_04793 NT01CX_2393 -376 34.5 TATATTCAGGTAGCAAAGTAGTTGAAAGTCTATGACGCAAAGCTAAAAGGCCTGTGAAATGGTAGCCAGTTGCACGT
CLOBOL_00226 null -182 53.7 AAAAAATAATTAGCAAAACTGGTGAAAGCTAGTGACGCAAAGCTACAGGGATTTCTCTCTAAAAAGAGGTGTCAGCCAGCTGCATGA
CLOBOL_00697 null -138 50.3 GTAAATATTGGGGCAAAGCACGTGAAAACGTGTGACGCAAAACTAGAGGGCCTGTAAGATGGCAGCCAGTTGCATTT
Clostridium butyricum 5521
CBY_3585 flgB -402 60.1 ATAATTGAATACGCAAAGTTAATGAAAGTTAATGACGCAAAGCTATAGGGACTAAGAATTTTATTAAGAATTTATGTCAGCCAGTTGCCGGG
CBY_0554 cheY -148 56 TTCATATTGGGCAAAGCAGTTGAAAAGCTGTGACGCAAAGCTAGAGGGCCTTTCTTATAGAATGGCAGCCAGTTGCATAAAT
Clostridium nexile DSM 1787
CLONEX_03566 null -402 25.1 ATAATCGCAAAGACAAACTTATAGAAATATGAGGATACAAAGGTAGAGGTCGAAGACCAATATGTATAGGCAGTTCGACTGTGATG
Clostridium sp. OhILAs
Clos_1635 pilA -243 40 TACAATAAATGGGCAAACCTAGGGACGCAAAGCTTGAGTCTACGGTTATCTCAAAGATAATTACGATCGTTCAGCTGCATAG
Clostridium kluyveri DSM 555
CKL_3514 null -242 70.9 ATATTGATAATAGCACACTTATTGAAAAATAAGGTCGCAAAGCTATGGGTCTAAAGAAAAGTTATTTTTCTATGATTGCCAGGTTGCCAAA
CKL_2324 fabH -207 69.9 ATTGATAATAGCACACTTATCGAAAGGTAGGGTCGCAAAGCTATGGGTCTTAAGAAAATTATTTTTCTATGATTGCCAGGTTGCCAAAGT
Clostridium difficile 630
CD2309 CD2309 -142 66.6 AACTAAATCGGCAAAACTAGAGAAATTTAGTGACGCAAAGCTATAGGGACTAACGCTTATAAAATAAGTTATGTCAGCCAGTTGCCAAAAA
CD1990 null -177 58.9 ATTCAGATATAGGCAATATTAGATAAATCTAATGACGCAAAACTATAGGGACTAAAATCTTTATGTAATAAAGGTCATGTCAGCCAGTTGCCAAA
CD2830 null -186 68.7 AAATTAAATGAGGCAAAACTAGGGAAACCTAGTCACGCAAAGCTATAGGGGCTAAAGTTTAGTAAACCATGCCAGCCAGTTGCCGAA
CD1424 CD2309 -151 60.7 AAAACTAAATCGGCAAAACTAGAGAAATTTAGTGACGCAAAGCTATAGGGACTAACGCTTATAAAATAAACTATGAGTTATGTCAGCCAGTTGCCAAA
CD2797 CD2797 -210 64.2 GAAAATTAAATGGCAAAATTAGGGAAATCTAATGACGCAAAACTATAGGGATTAAAGCTTTTAAAGCCATATCAGCCAGTTGCTAAA
CD0245 flgB -494 69.3 AACTAAATAGGCAAATCTAGAGAAATCTAGTGACGCAAAGCTATAGGGACTAAGGTTTATATACATAAACTATGTCAGCCAGTTGCCAAAAA
Clostridium perfringens ATCC 13124
CPF_1489 CD2797 -227 68 TTAAAAAAATGGGCAAAATTAGAGAAATCTAATGACGCAAAGCTATAGGGACTAAGGTTTATAACTATGTCAGCCAGTTGCCAAA
CPF_1073 CD2797 -282 70.7 TAATATATTGGCAAACCTAGGGAAATCTAGAGACGCAAAGCTAAAGGGGCTAAGGTTATATGATAACTATGCTAGCCAGTTGCCGAAGA
Clostridium novyi NT
NT01CX_0209 null -142 67.5 CCAACGATAAAGGCAAATTTAGTGAAAACTAGAGACGCAAAGCTAAAGGGCCTTCCTTAGTTATTAAGATGGCAGCCAGTTACCGAA
Clostridium tetani E88
CTC00472 Cbei_3975 -87 58.3 CACGATAAAGGCAAAACTATTGAAAGATAGTGACGCAAAGCTATAGGGTCTGTAAAATGACAGCCAGTTATCGAAAG
Clostridium phytofermentans ISDg
null CLOBOL_02760 -99 62.8 AACGATAATAGCAAACCTAGTGAAAACTAGCGACGCAAAACTATAGGGTCTTCCTTAGATATTCTAAGATGATAGCCAGTTACCGAAAG
null Cphy_1136 -229 67.3 TATAAATTTAGCAAACTAATTGAAAGATTAGGACGCAAAGCTATGGGTCTAAGGATATCATAATATCAACGATTGCCAGGTTACAGAAAA
Clostridium sp. SS2/1
CLOSS21_02742 null -173 56.3 AAGATTCTAGGCAAAACAGACGAAAGTCTGTGACGCAAAGCTAAAGGGCCTGTAAAATGGCAGCCAGTTGCAGAAAA
CLOSS21_01726 null -331 70.5 ATTATTTTAAAGGCAAACCTGTTGAAAAGCAGGGGCGCAAAGCCAGAAGGGACTAAAGTCAGAAAGCTTGACCATGTCAGCCGGTTGCCACT
CLOSS21_00843 null -474 75.9 TTTATTCATAGGGCAAACCTGTTGAAAGACAGGGACGCAAAGCCAGAAGGGTCTAAGGTCTTATTGGACTATGACAGCCGGTTGCCACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD