Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Chloroflexia

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_2639 ribD -335 90.1 CAAACCTTCGGGGCAGGGTGAGTCTGGAATTGAGTTTCACCTCAAGACCGGGCAATTCCCGATCGGTGGTATAGCCCACGAGCGGGTGGTCGCATTCGACACCTCGCACGATCCGGTGAAACTCCGGAGCCGACCGTACAGTCGGGATGAAAGAAGGTTGAGTA
Cagg_2734 ribX -280 109.1 AAACGATCTTCGGGGCAGGGTGAAATTCCCGATCGGTGGTATAGCCCACGAGCGTGTTGAGAGGCACGCAGGATCCGGTGAAACTCCGGGGCCGACGGTTATAGTCCGGATGTAAAGAAGATCCAG
Chloroflexus sp. Y-400-fl
Chy400_2370 ribD -283 111.8 AAGACCTTCGGGGCAAGGTGAAATTCCTGATCGGCGGTAATGGTGGCGTGCCCACACAAGCCCGCGAGCCGTAAGGCAGGACCCGGTGTGATTCCGGGGCCGACGGTATAGTCCGGATGGGAGAAGGTCGGCGG
Chy400_0882 ribX -279 106.7 ACGATCTTCGGGGCAGGGTGAAATTCCCGATCGGTGGTATAGCCCACGAGCGTGTTGAGAGGCACGCAGGATCCGGTGTAACTCCGGGGCCGACGGTTACAGTCCGGATGTAAAGAAGATCCAGAT
Roseiflexus castenholzii DSM 13941
Rcas_2389 ribX -386 97.6 CTACGATCTTCGGGGCAGGGTGAAATTCCCGATCGGCGGTGATGTGCAGGATGCTGCACCAGCCCGCGAGCCGCAAGGCAGGAGACCGGTGCGAAGCCGGCGCCGACGGTTACAGTCCGGATGGGAGAAGATCGGC
Roseiflexus sp. RS-1
RoseRS_0969 ribE -385 93.1 AGAACCTTCGGGGCAGGGTGAGTCCGGCAGGGCTGCCGGGCAATTCCCGATCGGTGGTACAGCCCACGAGCATCGTGCCTCACGGCAATGTGCACGATCCGGTGAAACTCCGGAGCCGACCGTACAGTCGGGATGGAAGAAGGTTGACCG
RoseRS_2763 ribX -360 97.3 GCACGATCTTCGGGGCAGGGTGAAATTCCCGATCGGCGGTGATGTGCAGCATGCTGCACCAGCCCGCGAGCCGAAAGGCAGGAGACCGGTGCGAAGCCGGCGCCGACGGTTACAGTCCGGATGGGAGAAGATCGGC
Herpetosiphon aurantiacus ATCC 23779
Haur_1578 ribX -285 99.7 TTGGTCTTCAGGGTTAGGTGAAATTCCTTATCGGCGGTGATGGTGGTTCAGCCACATAAGCCCGCGAGCCGCAAGGTAGGATGCTGGTGCGAATCCAGAGCCGACGGTTAAAGTCCGGATGGAAGAAGATCGATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD