Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU0436 in Desulfovibrionales

Properties
Regulator family: TetR
Regulation mode:
Biological process:
Effector:
Regulog: DVU0436 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU0436 null 10 7 TGGCTAAACGGTCGTTTAGAAA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1517 null -160 7 TTCTTAAACACTCGTTTAAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD