Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU0057 in Desulfovibrionales

Properties
Regulator family: TetR
Regulation mode:
Biological process:
Effector:
Regulog: DVU0057 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio salexigens DSM 2638
Desal_0950 null -37 6.7 GCTTCAAACAGTGTTTTAATT
Desulfovibrio vulgaris Hildenborough
DVU0057 null -31 6.7 GTTTCAAACAAGGGTTGAAAC
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2165 null -70 7 GGTTCAAACAATGATTGAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD