Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Chloroflexia

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_1279 btuR -262 62.7 GCAATTCCATACTCATCGCGGTGACCCGTTAGCCCGGATGCTAGGGCGTAAAGGTGGAAGCTGGTGAAAGTCCAGCGCTGTGTCGCAACTGTAACCGGATGTACTACGCCGGAAGCCAGGACGCCTGCCGCGATGTGTTCTCGTTCA
Cagg_2179 cbrX -313 47.3 TGTATCACCCCACCGGTAGGGAGCCCGGAGGAAGCGAAGGGCTTAATTGGGGGAAGTCCGGTCAAAGGCCGGCGCAGTCCACGCTACTGTAGGTCGCCATTGGCGACGAGCCAGAATGCCCGTCCCTACTCGTTCGCTATCAC
Chloroflexus sp. Y-400-fl
Chy400_2789 btuR -272 62.1 CAAGTTCGTAGATCGTCGCGGTGACCCGTTGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGAAAGTCCAGCACTGTGCCGCAACTGTAACCGGCTGTTTCAGGCCGGAAGTCAGGACGCCTGCCGCGATGTGTTGTTCGTTC
Chy400_0336 btuF -421 66.1 CAAGTTCATATCGTCGCGGTGACCCGTTGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGCAAGTCCAGCGCTGTGCCGCAACTGTAACCGGTTAGAAAGCCGGAAGCCAGGACGCCTGCCGCGATGTGATGATGTTCGGC
Chy400_1314 cbrX -267 37.6 ATCAGACCTGTCCTGTTGGGGTATGGTCTGAGCAACGGAAGCCGGTCCAAGGCCGGCGCAGTCCACGCTACTGTAGGTCGCGATGAGCGACGAGCCAGAATGCCCGTCCCTACACGTTCGCTTTCA
Roseiflexus castenholzii DSM 13941
Rcas_0649 btuR -424 61.3 TCAATCCAACGACCGTCGCGGTGACCCGCAGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGCAAGTCCAGCGCTGTGCCGCAACTGTAACCGGCGATTGTCAGCCGGAAGCCAGGACGCCTGCCGCGATGTCTGTTGTTCAG
Rcas_2247 null -325 64.2 CAAGTGAATACCATCGCGGTGACCCGCAGGCCCGGATGCCAGGGCATAAAGGTGGAAGCTGGTGCAAGTCCAGCGCTGTGCCGCAACTGTAACCGGCAATCGTTGCCGGAAGCCAGGACGCCTGCCGCGATGTTGATTGTGTTCGA
Roseiflexus sp. RS-1
RoseRS_0557 btuR -361 62 AATGCAACGACCGTCGCGGTGACCCGCAGGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGCAAGTCCAGCGCTGTGCCGCAACTGTAACCGGTTCGTAGTGCCGGAAGCCAGGATGCCTGCCGCGATGTATGTTGTTCAGCC
RoseRS_3085 null -197 65.4 CAAGTGAATACCATCGCGGTGACCCGCAGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGTAAGTCCAGCGCTGTGCCGCAACTGTAACCGGTGACAATCACCGGAAGCCAGGACGCCTGCCGCGATGTTGAATGTGTTCGA
RoseRS_3103 null -344 63.8 TAAACCTTTCAAACGTCGCGGTGACCCGCAGGCCCGGATGCCAGGGCGTAAAGGTGGAAGCTGGTGCAAGTCCAGCGCTGTGCCGCAACTGTAACCGATCGTATCGTCGGAAGCCAGGATGCCTGCCGCGACACTGTGTGTTCGA
Herpetosiphon aurantiacus ATCC 23779
Haur_3809 cbrX -213 47.7 ATCATAAATTGCTATTCAAATGTTGTGCAAACAGTTGGGGGAAATCCGGTGCAAATCCGGTGCAGTCCACGCTACGGTAAGCCTTTGGCCAAGCCCGAATACCCATTGAATAGTTGATTTCTGGGTT
Haur_1060 btuR -281 59.1 AATTTACAAGTTTGTTTGTGGTGCGTTGCTGTCCCGGATGACACATACGCGCAATGGGGGAAGCCAGTCTAAGTCTGGCGCTGTCCCGCAACGGTAGGAAGCCCACGCTTCAAGCCCGATAACCCGCCACAAACTCATCGACACTC
Haur_2575 nrdA -279 33.6 TACAAATTTTTTTGATCTGAGGCCAAGTGTCGTAGCTTGGCTGGAATATTGGGGAAAGTCCGGTGAGATTCCGGCACTGTCGCGCAACGGTATGGCTCAATGCTAAGTCCGAATGCCCACTCAGTTCGAGTTGATCAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD