Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GamR in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Regulog: GamR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus clausii KSM-K16
ABC0644 null -100 5.2 AAATTTGTAACTACCTATTT
ABC0644 null -124 5.7 ATATTTGTAATTACTAATCA
ABC0643 licH -97 5.2 AAATAGGTAGTTACAAATTT
ABC0643 licH -73 5.7 TGATTAGTAATTACAAATAT
ABC0646 chiA -60 4.8 GAATTAGTAGTAACAACTTT
Bacillus halodurans C-125
BH0913 BH0913 -60 4.6 TTATACGTAATGACAATTTT
BH0916 chiA -92 5.6 ATATTTGTTATTACATTTAT
BH0916 chiA -68 4.7 ATTTTAGTAGTAACTTTTAT
BH0916 chiA -44 5.2 AATATTGTTACTACAAATAA
BH0912 licH -74 5.6 TGATTAGTAGTAACAAATAT
BH0913 BH0913 -92 4.8 TTAATTGTAGTTACTTATTT
BH0913 BH0913 -116 5.6 ATATTTGTTACTACTAATCA
Bacillus licheniformis DSM 13
BLi00338 chiA -300 6.2 AAATTTGTCATAACAAATTT
BLi00335 licH -99 6.2 CAATTTGTTATAACAAATAT
BLi00335 licH -85 4.6 AAATATGTATGGACAAATTT
BLi00335 licH -71 5.2 AAATTTGTTATAACATGTTA
BLi00336 gamR -110 5.2 TAACATGTTATAACAAATTT
BLi00336 gamR -96 4.6 AAATTTGTCCATACATATTT
BLi00336 gamR -82 6.2 ATATTTGTTATAACAAATTG
Bacillus subtilis subsp. subtilis str. 168
BSU02360 gamA -75 5 AAATTCGTAATGACAAGTAT
BSU02360 gamA -52 5.9 AAATTGGTCATAACAAATAT
BSU02370 gamR -186 5.9 ATATTTGTTATGACCAATTT
BSU02370 gamR -163 5 ATACTTGTCATTACGAATTT
Oceanobacillus iheyensis HTE831
OB2273 licH -126 5.8 AATTGTGTTATAACAAATTT
OB2272 gamR -81 5.8 AAATTTGTTATAACACAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD