Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhnR in Caulobacterales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog: PhnR - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter segnis ATCC 21756
Cseg_3204 COG3511 -40 6 AATCTGGTCTATACCAAACT
Cseg_3212 omp -208 5.1 GATTTGGTATAGTCCAAAAT
Cseg_3212 omp -37 4.6 CCACTGGTCCATACCAGAGT
Cseg_3203 phnR -151 5.8 AGTTTGGTATAGACCAGATT
Caulobacter sp. K31
Caul_2987 COG3511 -39 5.9 ATTTTGGTCTATACCAGAAT
Caul_2987 COG3511 -115 3.9 CAACTGGATCAGACCACTGA
Caul_2995 omp -35 5.2 CAACTGGTTCATACCAGTTG
Caul_2985 Cseg_3202 -40 5.4 GATTTGGTCTAGACCAGAAC
Caul_2986 phnR -165 6.4 ATTCTGGTATAGACCAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD