Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhnR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog: PhnR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_2746 phnS -52 5.4 AAACTGGTACATACCAATTA
Ping_2747 phnW -227 4.6 TAATTGGTATGTACCAGTTT
Ping_2747 phnW -39 5.9 ATTCTGGTCTACACCAAAAA
Ping_2746 phnS -240 5.3 TTTTTGGTGTAGACCAGAAT
Psychromonas sp. CNPT3
PCNPT3_11559 phnS -253 5.4 TATTTGGTGTAGACCAGAAT
PCNPT3_11564 phnW -32 5.9 ATTCTGGTCTACACCAAATA
Moritella sp. PE36
PE36_23507 phnW -228 5.6 ATTCTGGTCTGTACCAGATT
PE36_23512 phnS -50 6.2 AATCTGGTACAGACCAGAAT
PE36_23512 phnS -261 5 CATTTGGACTATACCAGTTT
PE36_23517 phnT -24 5.5 ATACTGGTATAGTCCAAATA
PE36_23507 phnW -17 5.7 AAACTGGTATAGTCCAAATG
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_1937 phnR -18 6 CTTTTGGTATATACCAGAAT
AHA_1936 phnS -39 5.6 AATCTGGTTTATACCAAGCC
AHA_1935 phnT -36 6.1 AAACTGGTATATACCAAATC
AHA_1938 phnW -166 4.2 ACGTTGGTAGATACCAGTAT
AHA_1938 phnW -30 6.4 ATTCTGGTATATACCAAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD