Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhnR in Enterobacteriales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Regulog: PhnR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Salmonella typhimurium LT2
STM0431 phnW -28 6.2 AATCTGGTATAGACCAAAGG
STM0429 phnS -48 6 AACCTGGTATAGGCCAGAAA
STM0430 phnR -131 5.3 CCTTTGGTCTATACCAGATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_04063 phnW -29 6.5 AATCTGGTATAGACCAAATG
KPN_04061 phnS -45 6.2 AATCTGGTCTACACCAGAAT
KPN_04062 phnR -153 5.8 CATTTGGTCTATACCAGATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD