Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Clostridiaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_1224 ribD -447 111.3 GAAATCTTCGGGGTTGGGTGAAATTCCCTATCGGCGGTACAGCCCGCGAGCTTTAAAAAGCAGATTCGGTTAGATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGAGAGTAAT
Cbei_0464 ribU -306 121.2 TATATCTTCAGGGCAGGGTGTAAATCCCTACCGGCGGTATAGCCCGCGAGCTTTTAAGAAAGCAGATTCGGTGTAACTCCGAGGCCGACAGTATAGTCTGGATGAAAGAAGGTAACCTA
Clostridium difficile 630
CD1700 ribD -254 118.8 ACTTAATCTTCGGGGTAGGGTGAAATTCCCAATCGGCGGTATAGCCCGCGAGCCAAGGTAAAACTTGGTTGATTTGGTTAAATTCCAAAGCCGACAGTAAAGTCTGGATGGAAGAAGATATTT
CD3299 ribZ -289 97.5 TTTTTCTTCATAAACGGGTGAAATTCCCTATCGGCGGTAAAAGCCCGCGAGCCTTATGGCATAATTTGGTCATATTCCAAAGCCAACAGTAAAATCTGGATGGTAGAAGAAAATAGT
CD0147 ribU -268 123.2 AAGATCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTATAGCCCGCGAACTACTTAGGTGGTTGATTTGGTGAGATTCCAAAGCCGACAGTAAAGTCTGGATGAGAGAAGATATTTAT
Clostridium perfringens ATCC 13124
CPF_0546 ribD -465 122.3 AAATTCTTCAGGGCAGGGTGAAATTCCCTACCGGCGGTAAAGCCCGCGAGCTAGTTTAGCATGATTCGGTGAAACTCCGAGGCCGACAGTAAAGTCTGGATGAAAGAAGAATATCTA
CPF_2425 ribU -244 117.2 AAAAAGTCTTCAGGGCGGGGTGTAAGTCCCCACCGGCGGTAAAGCCCGCGAGCTAGTTTTTAGCATGATTCGGTGAAATTCCGAGGCCGACAGTATAGTCTGGATGAAAGAAGATGAGT
Clostridium novyi NT
NT01CX_0715 ribD -387 113.4 TTTAATCCTTCAGGGCAGGGTGAAATTCCCGACCGGCGGTAAAGTCCGCGAGCCACTTTAGTGGTTGATTTGGTGAGATTCCAAGACCGACAGTAAAGTCTGGATGGGAGAATAGGATTAA
NT01CX_0505 ribU -229 124.7 ATAGTATCTTCAGGGCAGGGTGTAATTCCCGACCGGCGGTTAAAGTCCGCGAGCTATACTTGGTATGGCTGATTTGGTGAGATTCCAAAACCGACAGTAAAGTCTGGATGAGAGAAGGTATAG
Clostridium botulinum A str. ATCC 3502
CBO2866 ribD -343 106.8 ATGAATCCTTCAGGGCGGGGCGCAATTCCCCACCGGCGGTAAAGTCCGCGAGCTACTTGTAGCATGATTCGGTGAAACTCCGAAACCGACAGTTAAAGTCTGGATGAAAGATAGGATTAT
CBO2921 ribB -366 111.8 GTATCCTTCAGGGTTGGGTGAAATTCCCTATCGGCGGTATAGCCCGCAAGCCATAAGGCAGATTCGGTTAAATTCCGAAGCCGACAGTATAGTCTGGATGAAAGAAGGTAAATAC
CBO0178 ribU -211 121 AATATCTTCAGGGCGGGGTGTAATTCCCCACCGGCGGTAAAGCCCGCGAGCTATTTTTAGCATGATTCGGTTAAATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGATTGCAAT
Clostridium acetobutylicum ATCC 824
CAC0590 ribD -170 110.4 ATGTTCTTCAGGGATGGGTGAAATTCCCAATCGGCGGTAAAGCCCGCAAGCCATTTGGCAGATCCGGTTAAACTCCGGGGCCGACAGTTAAAGTCTGGATGAAAGAAGAAATAGCG
CAC2841 ribU -198 121.5 GAATGATCTTCAGGGCAGGGTGAAATTCCCTACCGGCGGTATAGCCCGCGAGCCTTTTTAGGTATGATCCGGTTTGATTCCGGAGCCGACAGTAAAGTCTGGATGAAAGAAGATATAT
Clostridium tetani E88
CTC00671 ribD -254 108.5 ACATCCTTCAGGGTTTGGTGAGATTCCATACCGGTGGTAAAGCCCACGAGCCGCAAGGCAGATCTGGTGAAATTCCAGGGCCGACAGTTAAAGTCTGGATGAAAGAAGGAAATTAC
CTC00331 ribU -211 120.9 AATATCTTCAGGGCGGGGTGTAATTCCCCACCGGCGGTATAGCCCGCGAGCCGCAAGGCATGATTCGGTGTAACTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGGTATAATA
Clostridium phytofermentans ISDg
null ribU -395 94.2 AAGTTCTTCGGGGCAGGGGGTAGTTCCCGACCGGCGGTATAGTCCGCGACCGAGTTAATCTCGTTGATTTGGTGACAGTAAGGAAAGATTACTGAATTCCAAAACCGACAGTATAGTCTGGATGAAAGAAGAAGTTTGT
Clostridium cellulolyticum H10
Ccel_3408 ribU -226 116.2 AATATCTTCAGGGCAGGGTGCGATTCCCTACCGGCGGTAATGTACTATTTAGTATTAGCCCGCGAGCGTTTTGCAGACATGGTGTGATTCCATGGCCGACAGTACAGTCTGGATGAAAGAAGAAACAGCA
Ccel_2006 ribD -206 102.3 ATGACACTTCAGGGACAGGTGAAAATCCTTACCGGCGGTAGATAGCACAGCTATAAGCCCGCAAGCGAAAGCAGATCCGGTCAAACTCCGGAGCCGACAGTACAGTCTGGATGAAAGATAGTGTAT
Clostridium kluyveri DSM 555
CKL_2169 ribD -394 103.1 AATATGCTTTCGGGGCAGGGTGAAATTCCCGATCGGCGGTATAGTCCGCGAGCTGATTATCAGCAGGAACTGGTTGGATTCCAGTACCGACAGTAAAGTCTGGATGGAGAAAGTGGAA
CKL_3611 ribU -359 122.8 ATATAATCTTCAGGGCGGGGTGAAATTCCCCACCGGCGGTATAGCCCGCGAGCTGCGTGTTCAGCATGATTCAGTGAAATTCTGAAGCCGACAGTAAAGTCTGGATGGGAGAAGATAGAA
Clostridium sp. OhILAs
Clos_2474 ribU -277 117.9 TATGATTCTTCAGGGCAGGGTGAAATTCCCGACCGGCGGTATAGTCCGCGACTCGATATACATCGATTGAACTGGTGAGATTCCAGTACCGACAGTAAAGTCTGGATGGGAGAAGAAAAAG
Clostridium bartlettii DSM 16795
CLOBAR_00909 ribD -253 120.7 GATTATTCTTCGGGGCAGGGTGTAATTCCCGACCGGCGGTATAGCCCGCGAGCTACATTGTAGCTGATTTGGTGAGATTCCAAAGCCGACAGTAAAGTCTGGATGAAAGAAGATAAAA
CLOBAR_00632 fggY -211 121.3 TATATGTCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTAAAGCCCGCGAGCTATGAAAATAGTTGATTTGGTGAAAATCCAAAGCCGACAGTATAGTCTGGATGAGAGAAGAATGTT
CLOBAR_00719 ribU -231 119.4 AAAAAATCTTCGGGGCAGGGTGAAATTCCCTACCGGCGGTAAAGCCCGCGAACTATGAAAATAGCTGATTTGGTGAAATTCCAAAGCCGACAGTAGAGTCTGGATGAGAGAAGAGAGTT
Clostridium bolteae ATCC BAA-613
CLOBOL_02256 ribU -352 114.4 TAAAGTTCTTCGGGGCAGGGTGTGATTCCCTACCGGCGGTAATAGTCCGCGACCCGCTACGGCGGCTGATCTGGTGTGATTCCAGAACCGACAGTATAGTCTGGATGAGAGAAGAAGGTG
Clostridium butyricum 5521
CBY_0685 ribD -423 112.2 TATTAATCTTCAGGGCAGGGTGTAATTCCCTACTGGCGGTATAGCCCGCGAGCTTATTATTAGCAGATTCGGTTAAATTCCGAGGCCAACAGTATAGTCTGGATAAAAGAAGAGTATT
CBY_3957 ribU -276 118.9 TATATCTTCAGGGCAGGGTGAAAATCCCTACTGGCGGTACAGCCCGCGAGCTATTTTAGCAGATTCGGTGTAATTCCGAAGCCAACAGTATAGTCTGGATGAAAGAAGGTAACCTA
Clostridium hiranonis DSM 13275
CLOHIR_00483 ribD -211 123 ACTATCTTCAGGGCAGGGTGAAATTCCCTACCGGTGGTAAAGCCCACGAGCTGCAAAGCATGATTCGGTGTAATTCCGAAGCCGACAGTAAAGTCTGGATGAAAGAAGATGAAAAG
CLOHIR_01113 ribU -311 112.6 GATGTCTTCAGGGCAGGGTGAGATTCCCGACCGGCGGTATAGTCCGCGAGCGTTTTTTAAAACGCAGGAATTGGCATAAGTTCAATTCAGGATTTGGTGAAATTCCAAAACCGACAGTATAGTCTGGATGAGAGAAGATGTGTTA
Clostridium leptum DSM 753
CLOLEP_01531 ribU -210 119.7 GCTGTCTTCGGGGCGGGGTGAAAGTCCCCACCGGCGGTAACCCTTTCAAACATGGGAAGCCCGCGAGCTGCTTGCTGATCTGGTGAGATTCCAGAGCCGACGGTATAGTCCGGATGGAAGAAGAAAAGAAG
Clostridium nexile DSM 1787
CLONEX_02849 ribU -239 113.4 GGATTCTTCGGGGCAGGGTGTAATTCCCTACCGGCGGTTACAGTCCGCGACCCATGAAAATGGCTGAACTGGTGGAATTCCAGTACCGACAGTAAAGTCTGGATGTGAGAAGAAGGTGTG
Clostridium scindens ATCC 35704
CLOSCI_02146 ribU -142 109.6 AGAGATTCTTCGGGGTCGGGTGCAAATCCCAACCGGCGGTATAGTCCGCGACCCGGCGCGTTTATCCGCGCTGGCTGATCTGGTGCAATTCCGGAACCGACAGTAAAGTCTGGATGAGAGAAGAATTAT
CLOSCI_02942 ribU -192 91.4 GAAGTCTTTGTGGCAGGGTGCAAATCCCTACCGATGGTATAGTCCATGACCCGCGCAAGCGGCTGATCTGGTGACCTTTTTGAGGAATTCCAGAACCGACGGTATAGTCCGGATGAGAAAAGACATTTTC
Clostridium sp. L2-50
CLOL250_02833 ribE -457 105.8 TTGAAGTCTTCAGGGCGGGGTTAGTTTCCCCACCGGCGGTATACATAGTAATCTATGTGAGCCCGCGAGCCGTAAGGCATGATTTGGTGAGAATCCAAAGCCGACAGTAAAGTCTGGATGAAAGAAGAATGCA
Clostridium sp. SS2/1
CLOSS21_03172 ribD -336 117.5 AACGTCTTCAGGGCAGGGTGCAAGTCCCTACCGGCGGTTATAGCCCGCGAGCCTTATATGGCATGACTTGGTGAGATTCCAAGGCCGACAGTACAGTCTGGATGGAAGAAGATTTAAGA
CLOSS21_01003 ribB -278 114.9 AAAATCTTCAGGGCAGGGTGAAAATCCCTACCGGTGGTAAAGCCCACGAGCCGTAAGGCATGATTCGGTGAAATTCCGAAGCCGACAGTATAGTCTGGATGAAAGAAGAAAAAAAC
CLOSS21_01295 ribU -291 88.7 TCTCCAACTTCAGGGCAGAGTGAGATACGAAAGTATCAATTCTCGACTGGCGGTGATACTCCAAGAGAGGCAAGTCCGCGAGCGTTTGGCCGATCAGGTTAGAATCCTGAACCAACAGTATAGTCTGGATGAAAGAAGTAGTTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD