Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Clostridiaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Clostridiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_2309 cbiK -449 79.3 ATAAGAAATGATTTTTAGGTTCATATAAAGTTAAGTGTATATGATTAAAAGGGAAAGTGGTTAAAATCCACTACAGCCCCCGCTACTGTGATGGAAGACTAATCTCTAAAGTATATAATAAAAGTGCTCATTAATTAAGAATTGGCTGCTTTTAAATAGTATACTAAAAAATCCACTGAGAAATTTTCTTGGGAAGGAAGAGAATTAGGATGAGGCCAAAGTCAGGAGACCTGCCTAGGAGTTTATAAAAATGCT
Clostridium difficile 630
CD2999 btuF1 -401 107.1 TAAATTAAAATAATACTAGGGTACTATATTAGTTTAATAGGGAAAGTGATGAAAATTCACTACAGCCCCCGCTACTGTATACGGATACGAAATCAAAATCCACTGAAATTTATAAAAATTTTGGGAAGGGTGATGGAGGAAAAGCCGTGAGTCAGGAGACCTGCCCAGTATTATATAAGTTCA
CD0324 cbiM -373 102.8 AAATATATAATATTATAGGTTCTTTAAGCAAGATTAATAGGGAAAAAGGTTAAATTCCTTTACAGCCCCCGCTACTGTGATGCAGACGAAACTTTTGTTAGCCACTATGATGATATTTTTTATATCTCATGGGAAGGAAAAGGAGTAGGATGAAGCTAAGTCAGGAGACCTGCCTAAAATATTAAAGTAATTTC
CD3435 cbiP -295 102.1 GAATATTAGATTAAAATTAGGTTCTTAATTAGATGTTAAAAGGGAAAAAGGTTAGATGCCTTTGCAGCCCCCGCTACTGTGAAACCAACGAAACTATAAATACCACTGTCAGTTTGATGGGAAGGTTATAGAAGTAGGATGAAGTTAAGCCAGGATACCTGCCTAATTTAATTTAAAACAA
Clostridium perfringens ATCC 13124
CPF_1515 cblT -544 89.4 AAATAAAATAAGAGCATTAGGTGTTTAGTAACTTAATAGGGAAAGTTAAAAACTGCAGCCCCCGCTACTGTTGATAAGGACGAGAACAAAAAGCCACTGTGATAAATAGTCATGGAAAGGATTGTTTTAGGATGATTTATTAGCCAGGAGACCTGCCTAGTATGCTATTCTTATT
CPF_1436 cbiK -302 115.4 ATAATATTTTATATTTTTAGGTTTGATTTTAATTAAAAGGGAAAGTGGTTAAAGTCCACTACAGCCCCCGCTACTGTGATAGGATACAAGTTTCTATTTGACCACTGATTATATAAATTGGGAAGGGAGAAATGAGGATAAGCCTTAAGTCAGGATACCTGCCTAAAGATCATGAACTAAG
CPF_0185 cbiM -486 93.5 TTAAATATTTAGAAATAGGTTAAATAGTTACATTTGTAACTATATATTAAAAGGGAAGTTGGGTTTAAATCCCACGCGGTCCCGCCGCTGTAATAGAGGAGCTTTTTGTACTTTAAGCCACTGGAATATAATATTTTGGGAAGGCCACAAAAAGTGATGATACTTAAGCCAGAAGACCTGCCTATTTTTAAAACATCAAGAT
CPF_1296 btuF -488 84.2 TTGATTAACTAATAATTGGTGTGATTTTCGCTTAATAGGGAATGAAGTTAAAGTCTTCAACTACCTCAGTAACCGTGAAGCAGACAAAATCTCAATATGTCACTGCATTTTTTGTGTGGGAAGACGAGATGGAGGAAGAAGCAAAGTCGGGATACCTGCCTTTTATTTAAGTACTATTAT
Clostridium novyi NT
NT01CX_0583 cbiA -301 119.1 AAAATTGTATATTAGCTTAGGTGTCTGATTAATTTCAGGTGAAAAGGGAATACGGTGAAAATCCGTAACAGCCCCCGCTACTGTAATGTGGACAAATCTAAAACCACTGGTTTATAACCGGGAAGGAAGAGGAGGATGAAACTAAGTCAGGAGACCTGCCTAAGCTTTGGATAAAGAC
NT01CX_1329 cbiM -349 95.8 AAAATACATACAAAGTAGGTGTCAGTTATAATTGAAAGTTTGATTATGAACTGGTGAAAAGGGAAGCTGGGTGAAAGTCCCACACGGTCCCGCCGCTGTAAGAGAGGAGTTTTTCTTAACAAAACCACTGGTATCTTAAGATATTGGGAAGGGTAGAAAAATTATGATACTCAAGTCAGAAGACCTGCCTATTTTTGTACACCAATGAA
NT01CX_2077 cobT -298 107 AATTAAATAAGTCATTAGGTGCTCTATTATAAGAGGTAAAAGGGAAAGTGGTTAAAATCCACTGCAGCCCCCGCTACTGTAAATGAGGATGAAATCTAAATTGCCATCCATAAGGAGAAGGTTAGAAAGTAATATGATCCATAAGCCAGGAAACCTGCCTAATGTACGATTATTTAAGT
Clostridium botulinum A str. ATCC 3502
CBO0914 cbiP -323 122.7 TTTAATAAAAAGATTTAGGTGCCTTTACATAAAAGGTGAAAAGGGAATGTGGTAAAAGCCACAGCAGCCCCCGCTACTGTAATTGAGGACAAATCTTTCATAAACCACTCTTTAAAAAGGGGAAGGGAAAGATTAGGATGAATCATGAGCCAGGAGACCTGCCTAGATTTTTATTAGGGAAAC
Clostridium acetobutylicum ATCC 824
CAC2441 btuF1 -338 119.8 AATAATACCATATTTTAGGCACCTAATCTTAGGTTTAATAGGGAAATTGGTGAAAATCCAATGCAACCCCCGTTACTGTATACAGTTACAAAACCAATGTCCACTGGAGTTTTCTCTGGGAAGGATGGTTGAGGCTAAACTGTGAGCCAGGAGACCTACCTAAAATATTATGGAACTTCG
CAC1365 cbiM -313 105.4 TGCTACTAAAATTTGTAGGTTCAACTGAGGAGTCTTAGTTGATTAAAAAGGAATCAGGTGAAAAGCCTGAGCGGTCCCGCCACTGTAATAAAGGAGTTTAAGTACAATATGTCACTGGGAAACTGGGAAGGCGTACTTAAGCAATGATTTTTGAGCCAGGATACTTGCCATATTCTAGTATGTTTTTTC
Clostridium tetani E88
CTC01372 btuF1 -324 103.2 CATTTATAGAATAAATTTAGGTGCTTATAGCTTAATAGGGAAGCAGGTGAAAATCCTGAACGGTCCCGCCGCTGTGATGGGGAGTTTTTTCAAAGTAAACCACTGGATAATATATCTGGGAAGGTATGAAAAAATAATGAACCTAAGTCAGAATACCTACCTAAATTAAATACACTATA
CTC02290 cobT -410 111.1 AATTTAATATTAGATTTTAGGTGTGATCTTATAATTACTTAAAAGAGAAAGTGGTGAAAATCCACTACAGCCCCCGCTACTGTAATAGTGGACGATTCCTATTATCCACCAGTTAACTGGGAAGGAAGGATAAGGAAGAAACTAAAGTCAGGAGAACTGCCTAAAATATATTACTTCGG
CTC01400 dppA -305 121.7 ATATTATGAATTTTTATGGTGTAATTTCACATTACGTAAAAGGGAAGCTTGGTGTAAATCCAGCACGGTCCCGCCACTGTAAGAGAGAGTATATCATTATATGCCACTGTTGTTTATCAATGGGAAGGCAATGATGTACTATGATCTCAAGTCAGGAGACCTACCATAAAAACTTATACAATTTG
CTC00960 btuF -301 100.5 AATGTTTTATGAAAATAGGTTTAATAACTTTAATTAAAAGGGAAGTTGGGTGAAAATCCCACGCGGTACCGCCGCTGTAAGAGAGAAGTTTTCTTCTATTATGCCACTGTTTTTTAATGGGAAGGCAGAAGAAAATTATGATACTCGAGCCAGAATATCTGCCTATTTTATTCACTATAGCTC
CTC00745 null -277 98.2 ATAATATGAATAAAAAAGGTGAAATAGTTATTTCTTAAAAGGGAAGCATGGTGAAAATCCATCACGGTCCCGCCACTGTAATCAGGGAGTTAGGTTTTACCACTGTTAATTAACGGGAAGGAGAATCTATAAAAACTATGAACTGTAAGTCAGGAGACCTGCCTTTTTTTAATTAAACATTCC
CTC01379 dppA -288 100.8 TTAATATAATAAGACAACAGGTTTGAAATAATATTTATTATTTCAATTAAAAGGGAAACAGGTGTAACTCCTGTACGGTCCCGCCGCTGTAATAAAAGAGTAGTGCAGAATATGCCACTGTTAATATGGGAAGGCTTTGTACTATGTTGATTTTTAAGTCAGAAGACCTGCCTGTTGTTATAGATCATAC
CTC00778 null -405 115.7 TAAATATTTATTTATAAAGTTTCTTGTAAAAGAGAATTAAAAGGGAAGGAGGCGAAAATCCTCCACGGTCCGGCCACTGTAATTGGTGAGTTTATTCCATAAGCCATTGAGATATTCTTGAGAAGGCGGAAATAAATGATGAACCATAAGTCAGGAGACCTGCTTTATAAGAATAAATATACAG
CTC00720 cbiP -400 126.4 GAATATGAAAATATTCAGGTGCCATTTTAGGTTTAAAAGGGAATGTGGTTTAATTCCACAGCAGCCCCCGCTACTGTAATTGAGGACGAATCTTTCACAAACCACTCTTTCAAAAAGGGAAGGGGAAGGGAAAGACAAGGGTGAATCATGAGCCAGGAGACCTGCCTGTATATGAAAGATAAACTT
Clostridium phytofermentans ISDg
null cobT -429 95.9 AAAATATAATGTAGAGAGGTGCCTTGGCATGATTTATAGCCAAGGATAATAGGGAAATGGGTGAAAAATCCCATGCGGTCCCGCCGCTGTAATGGAAGAGCATACTTCACTTACGAATGTAGGACATGTCACTGAGTAATCGGGAAGACTGTAGTATGTGCTGAAGCCAAAGCCAGAAGACCTGCCTCACTATAAGAAATAACACA
null btuF -401 107.9 AATAATTGCGACCATGTGGTGCTTCTTAATATAAGTTAAAAGGGAATGTGGTGAAAATCCACAGCAGCCCCCGTTACTGTCAATGGAATGAAAATTGCGGAAGTGTCATTGTATCTTCTTTAGCGTTAAGGATACGGCTCCTAGCCTTAAAAAGCGAAGAATGATATGAGAAGACAGCAATGAGTAAAATGACCATGAGCCAGGAAACCTGCCATATGAGAATGAATCATCTG
null cbiQ -371 50.2 GAAGTTGGGTGCAATTCCCACACAGGAGCGCTACTGTGATAACGGAGCAGTTTTCGAAAAGAACCTGAATAGTATGTTCTTTGACCACTGGAAGTAATTCTGGGAAGGTGAAAAATTTGCGGTGATGTTTAAGTCAGAATACAT
null hemA -362 109.4 ACAATTTAGATCTTTAAGGTGCTTGGTGTCATGCCGTTAGGTATTGAAGTCCAAGATAATAGGGAAATGGGTGAAAATCCCATACGGTCTCGCCGCTGTGAAGGAAGAATCATATCTTGAATATCACTGTGTAAAATTACATGGGAAGATGAGATATGGTGTTGACGCCTGAGTCAGAAGACCTGCCTTAAGATAGTTTTTACACTT
Clostridium cellulolyticum H10
Ccel_3204 btuF -322 78.9 TTTTATATTAATATAATCAGTATAACTTAATATTATAAACAACAGATAAGGGAAGCAGGTTCGAAACCTGCACGGTCCCGCCGCTGTGTTGGAGGAGTTCTCCAAAATATCCACTGGTACATTAACCGGGAAGGGTTGGAGAGTGTTGATGCCTAAGTCAGAATACCTGTCTGTATGTTTGCACTGGTA
Ccel_1266 cbiM -380 95.6 TAATAATTAACGATATTGGTTTGCTCAAAATTATGAGTAACTAAGAGGGAATCAGGTGAAAATCCTGAACAGTCCTGCTGCCGTATGATGGAGCGGTTCTCTAAAAGCAAGATTTATTTTTTGCTATATATGCCACTGGGTAAATCAGCCCGGGAAGGTGAGAACTTTGCTATGATATCTGAGTCGGAAGACCTGCCAGTATTTCTGCAGATGCCAA
Clostridium kluyveri DSM 555
CKL_3429 cbiM -345 89.1 AATTTAATAATAAAATATAGGTTTAATCAATTAATTGATTAATTAAAAGGGAATCAGGTGAAATTCCTGGACTATCCCGTAGCTGTATTAGATGAATTTAAATACATTAGAAACCACTTGGAAACAGGGAAGGGGTATTTAAGTGATGATTCTTGAGTCAGAAGACCTGCCTATATTTTTGACTATGGT
Clostridium sp. OhILAs
Clos_1011 cbiM -432 121.8 GTAAATAAGAAGCATTAGGTTCTAAAAGATTAATAGGGAAATCGGTTAAATTCCGATACAGCCCCCGCTACTGTAAGTGTGTACGAAACCAACGGGTCCACTGGATAATATCTGGGAAGGTGTTGGGAGTAGGTTGATCCACGAGTCAGGAGACCTGCCTAATTGCTTGTATGAAGTAA
Clos_0622 THA_169 -356 106.1 TAAATAGAATGACCATGGGTACAACGATATATTGGATATCGTTGTTTAAAAGGGAAGATCGGTTAAAATCCGACACGGTCCCGCCACTGTAATGGATAGAGCTTTACGGATACCACTGTGCTTTTAAGGCATGGGAAGGTGTAAAGCTTGTAATTCCTTAGTCAGGAGACCTGCCAATGGAAAAAGCGCTGTTGA
Clos_2330 btuF -297 48.7 ATAAAATATTTAAAATCTAGGTTTAGTAGATACTTTGTATTTGCTAATTAAAAGGAAGTTGGGTGAAAATCCCACACGGTCCCGCCACTGTAAGGGCTTTGCTTTTCAATAGAGATGGAAAAATTCTCAGAGAAAGCATGCTCAAGTCAGATACTGCCTGATTTTCTGCACTGTGA
Clos_0948 btuF1 -340 107.5 TGAATATCAAAGTATTAGGGTTCTCTACTTAGAGATATTAGGGAAATTGGTGCAAAGCCAATACAGCCCCCGCTACTGTAAACATGGACGAGTTCTAAAAGCCACTGGATTTAATCTGGGAAGGCAGAAGGAGGAAGAAGTGTGAGTCAGGATACCTAACTAATACTTGGCATGGTTTTC
Clos_2212 cbiB -319 118.4 ACAAATTAAATAGTTTTAAGGTCTTTAGAATATAAAGTTAAAAGAGAAAGAGGTTCAATTCCTCTACAGCCCCCGCTACTGTAATCAGGTATGAAATCTTCAAATCCACTGGGAAACCGGGAAGGGAAGATAGTAAGTCGATCTGTAAGTCAGGAGAACTGCCTTAAAAATAAGAATCACA
Clos_0862 cbiA -309 57.4 AATTTGGAAGCTGGGTGAAATTCCCACACTGTCCCGCAACTGTAATAGCAAAGTAGAGACAATAGGTCATTGGGAAGACTGTTGTATACGTGAAGGCTTAAGTCAGGATACAAAT
Clos_0915 btuF -313 116.3 ACGAATTCAATATAGAAGGTGCTCAATTGAGCTTAAAAGGGAAAATGGTTAAAATCCATTACAGCCCCCGCTACTGTAGGTGATGATGAATCGGCAATGAACCACTGATCTAGGAATTTAAAGCTAGGTTGGGAAGGTGCTGAGGAAAATGATTCACGAGTCAGGAGACCTGCCGACTTTAGATAAATGATACC
Clos_0318 btuF -343 126 AAATGAATACATTTTATGGTTCTTTCTTATGAAAGCTAAGAGGGAAAGAGGTGAGAAACCTCTGCAGCCCCCGCTACTGTAAGCAGGACGAAATTCCAATAAACCACTGTGTAAATGGGAAGGTAGGAAGAGTAGGAAGAGTGCAAGCCAGGAGACCTGCCATAAAACGTGAATGAAGCTG
Clostridium bartlettii DSM 16795
CLOBAR_00570 null -320 94.4 AAAAATAAGTAGTTATAAAAGTTCTATTTAATAGACTAACAGGGAAATTGGTGCAAATCCAATGCGATCCCGTCACTGTGATAAAGGGTTAATTTTAAAACCACTGGATATATATCTGGGAAGGTAAGATTAACAATGCTTTTCAGCCAGGATACCTGCTTTTATAAAAAATAGAGAA
CLOBAR_01422 cbiP -274 71.8 AGGGAAAAAGGTACAAGCCTTTACAGCCCCCGCTACTGTGAAATGGACGAAACTATAAAGGCCACTGTTTGAAAAAATGGGAAGGTATAGGAGTAGGATGAAGTTAAGTCAGGATACC
CLOBAR_01388 cbiM -386 114.7 AGATGAAATGTATATTTTAGGTTCTTAACTGGATTAATAGGGAAAGAGGTGAAATCCCTCTACAGCCCCCGCTACTGTAATGTTGACGGAACTCTCAAATACCACTGTGATAATAAATCATGGGAAGGTGAGAAGATGGATGATACTAAGTCAGGAGACCTGCCTAAGATATAAAGTAATTT
CLOBAR_00841 dppB -480 108.2 TGAATTGAATATTGTTCAAGGTGCATTTCAACAATGCTTAATAGGGAATGTGGTGAGAAGCCACAGCAGCCCCCGCTACTGTAAGGATGACGAAAGCTTAAGGTTTTGGAGAACTTATGCTCCACTGTTAAATCGGGAAGGAGAAGTTAGTAGAATGATTCCAAGCCAGGAGACCTGCCTAAAATGATACATGCTCT
Clostridium bolteae ATCC BAA-613
CLOBOL_07302 nikA -325 104.9 CGAACATAACCGTATCAGGTCACCTTTGGGTTTAACAGCTGCAAAGGGTGAAAAGGGAATCAGGTGAAAATCCTGAGCGAACCGGTCACTGTAAATGTGGAGAAACCTCCGGACAGACCATTGCATATATTTGCGAGAAGGTGGGGGGATTGAAGATGCATAAGCCAGGAGACCTGCCTGATAGGAAAAACGGCGGCG
Clostridium butyricum 5521
CBY_3393 cbiK -357 110.9 TAATAAATATGATTATAGGTTTTGGTTAGTATAAGTCTAATTAAATTAAAAGGGAAAGCAGTTAAAGTCTGCTACAGCCCCCGCTACTGTAATGGAGTACTGTCTCAAATAACCACTGGAATTTAATTCTGGGAAGGGTGAGTGTTCAGGTTGATACCAAAGTCAGGAGACCTGCCTATAAAATTTTGACTATTAC
CBY_1415 cbiM -417 102.4 CAAAAATATAATTATAGAAGGTGCCTGTGATTTCTCCGCAGGATAATAGGGAAAAGGGTGAAAATCCCTTACGGTCCCGCCGCTGTATTGGAAGAGTTATATCTTAAAAATATGTCACTGGATTTTCTGGGAAGACAAGATATGATTATGAAACCTAAGTCAGAATACCTGCCTTTTATAAGCGTATGTAT
Clostridium hiranonis DSM 13275
CLOHIR_01689 cbiM -403 101.9 GAATATAAATAGTTTTCGGTTTCCGCAAGGAATTAATAAGGAATCAGGTGAAAGACCTGAGCAGCCCCCGTTACTGTGAAGCTGACGAAAGTTAGAATAAAGCCACTGTAATTATAAATTATGGGAAGGTTAATGAGTAGGATGAAGCAAAGCCAGGAGACTTGCCGAAAATATAGAGTAAATTTC
Clostridium leptum DSM 753
CLOLEP_00712 null -293 99.6 TCGGTCAATAGTCTTGCGGTTCGCGACGCGAATAATAGGGAACGGGGTGAAAGGCCCCGGCAGCTCACTCTACTGTAAGAAGGACGAAAGGCAGCTGTCACTGGGAGAATCCCGGGAAGACGCTGAGTAGGAGGATTTCAAGCCAGGAGACCTGCCGCTGAGACAAGCAAAGACGT
Clostridium nexile DSM 1787
CLONEX_02595 null -393 110.5 AGAGTGAAAATGTATGCGGTTGCTTTTGAATGATACAAAAGCATGAAAAGGGAATCCGGTGAAAAACCGGAGCAGTCACCTCTACTGTAACGCGGACGATGAGACAATAGGCCATTGACAGAATAATGTTGAGAAGGTGTTTTCAAAGAAAGATGCGAAGCCAGGAGACCTGCCGTATATAGGAAAGAATGTTT
Clostridium scindens ATCC 35704
CLOSCI_03609 cbiM -376 65.3 ACTTATTGTGGTCATATTGTGGTAACAGCAATATGAATGGACAAGGGAACCAGGTGCGAATCCTGGACGGTACCGCCGCTGTATGCGCCGAGCCTGTAATTCGTTGGCGAAAGCCAGTCATTGGGAAACCGAGAAGGCAGAATGCAGGCGCTGAGACTTCAAGCAAGTGTCGTAAGCGCGAGTCAGAAGACCTACAAGAAGAGGGATTGCTGATTG
CLOSCI_02169 cobW -248 109.7 TAATAACAGTAACGTATATAGTGATGCGAAGGCATTGAAAAGGGAATCTGGTGCGAATCCAGGACAGCCCGCTCTACTGTGTGATGGACGATCGTCCCATAAGCCACCCGGTCAGCCGGGGAAGGCGGGACTTGAGGATGAGATCGAGTCAGGAGACCTGCTATATATAGAAGATTCTTT
Clostridium sp. SS2/1
CLOSS21_00425 null -306 91.3 GAAATGCATAATTTCATGGTGATCTGTAATTACAGATCTTAAACTGGAATCAGGTGCAAATCCTGAGCGGTCCCGCCGCCGTGATAAGAAGTCAAAGCAACATACCACTGGGAAACTGGGAAGGTGCCAAGACGATGATCTTAAGCCGGAATACTTGCCATGATCTAAGGATATACTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD