Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PsrA in Various betaproteobacteria

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azoarcus sp. EbN1
c1A220 psrA -28 6.3 ATTAAAACGATCGTTTGAAT
Thauera sp. MZ1T
Tmz1t_0804 psrA -34 4.7 AAGAAAACGTATGATTCAAA
Tmz1t_0804 psrA -21 6.2 ATTCAAACAAACGTTTGAAA
Dechloromonas aromatica RCB
Daro_1543 psrA -34 6 ATTCAAACGAACGTATGAAT
Daro_1548 fadL -122 4.7 TTTCCAACAGTCATTTGAAT
Daro_1548 fadL -83 5.8 TTTCAAACGTTTGTTTGAGA
Daro_1549 acdB -58 6 ATTCAAACGTTCGTTTTATT
Chromobacterium violaceum ATCC 12472
CV2724 psrA -84 5.6 GTTAAAACGTAAGTTTGAAA
CV2724 psrA -71 5.3 TTTGAAACGCTTGTTCGAAA
CV2721 fadL -136 4.8 CATTAAACGAACGTTTGGAA
CV2720 acdB -257 5.1 ATAAAAGCGAGTGTTTGATA
CV1459 fadD -137 4.7 GATCAAACCGCGGTTTGATC
CV3350 null -24 6.1 ATCCAAACGACCGTTTGAAT
CV3818 etfB -101 5.9 AACCAAACGCTCGTTTGAAT
CV2194 fabK -78 6 ATTAAAACATTCGTTTGAAA
CV1785 acdH -106 5.7 ATTTAAACAAACGTTTGAAC
CV3916 etfD -108 5.7 GTTTAAACGCTTGTTTGATT
CV3412 fabF -91 5.6 TTCCAAACGCGCGTTTGAAC
CV4051 fadD -18 5.2 ATTAAAACCATCGTTTGCAT
Laribacter hongkongensis HLHK9
LHK_01607 psrA -38 5.4 ATTAAAACGTAAGTTTCAAA
LHK_01607 psrA -25 5.6 TTTCAAACAACTGTTTGGAT
LHK_01608 fadL -142 5.6 TATAAAACGGCTGTTTGAAA
LHK_01608 fadL -63 4.9 TCTCAAACGATCGTTTGCCT
LHK_02202 null -22 5.6 TTTCAAACGATCGTTTGCTT
LHK_01931 fadD -107 5.6 AATCAAACGACCGTTTGGCT
LHK_02913 etfB -187 6.1 ATTCAAACGACTGTTTGAAG
LHK_00049 fadH 43 6 AATCAAACGGTCGTTTGACA
LHK_02264 acdH -54 6 ATCCAAACATTCGTTTGAAA
LHK_02264 acdH -21 5.5 TTTCAAACGGTCGTTTAACC
LHK_00066 null -68 5.9 ATTCAAACAGTCGTTTGATG
LHK_02892 etfD -97 5.9 ATTCAAACGGCCGTTTGACG
LHK_02384 null -88 5.8 GTTCAAACGATCGTTTTATT
LHK_02406 scp -40 5.8 TATCAAACACTCGTTTGATA
LHK_00568 fabF -90 5.4 AGGCAAACGCCCGTTTGACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD