Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PsrA in Pseudomonadaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA3006 psrA -45 5 GCTGAAACGTATGTTTCAAA
PA3006 psrA -32 5.8 TTTCAAACAAGTGTTTGTCA
PA0506 acdH1 -139 5.5 TTTCAAACGCCTGTTTGAGA
PA1831 null -84 5.7 ATTCAAACAAGCGTATGTTT
PA3014 fadB -180 5.5 AGTCAAACGGGCGTATGAAT
PA2953 etfD -122 5.9 ATTCAAACAAACGTTTGTAT
PA3622 rpoS -427 4.8 CCTCAAACGGAAGTTTGAAT
PA5255 algQ -196 5.5 GATCAAACATCCGTATGAAT
PA2952 etfB -218 5.6 ATACAAACGTTTGTTTGAAT
Pseudomonas entomophila L48
PSEEN2270 null -99 5.2 GTTCAAACGACCTTTTCAAA
PSEEN3720 psrA -45 4.7 CCTGAAACGTATGTTTCAAA
PSEEN3720 psrA -32 5.7 TTTCAAACAACTGTTTGTCA
PSEEN3648 null -72 5.4 TTTCAAACGTATGTTTGAGC
PSEEN1703 fadH -102 4.9 GTTCAAACGCCTGTTTAATG
PSEEN3658 etfB -391 5.6 ATACAAACGTTTGTTTGAAT
PSEEN3660 etfD -153 5.9 ATTCAAACAAACGTTTGTAT
PSEEN4189 rpoS -428 5.1 CTTCAAACGGTAGTTTGAAT
PSEEN0159 algQ -182 5.1 GATTAAACGCTTGTATGAAC
PSEEN5115 acdH1 -87 5.7 TTTCAAACAACTGTTTGACC
PSEEN2270 null -86 5.7 TTTCAAACGCTTGTATGTTT
PSEEN3728 fadB -162 5.7 AATCAAACGGGCGTATGAAT
Pseudomonas putida KT2440
PP2144 psrA -54 5 GCTGAAACGTATGTTTCAAA
PP2144 psrA -41 5.7 TTTCAAACACCTGTTTGTCT
PP4195 null -83 5.5 TTTCAAACGACTGTTTGAGC
PP2008 fadH -54 5 ATTCAAACGGCTGTTTAATG
PP2136 fadB -161 5.7 AATCAAACGGGCGTATGAAT
PP4202 etfB -392 5.6 ATACAAACGTTTGTTTGAAT
PP3923 null -98 5.3 TTTCAAACAACCTTTTCAAA
PP3923 null -85 5.7 TTTCAAACGCTTGTATGTTT
PP4203 etfD -163 5.9 ATTCAAACAAACGTTTGTAT
PP1623 rpoS -431 5.1 CTTCAAACGGTAGTTTGAAT
PP0191 algQ -182 5.2 TATTAAACACTTGTATGAAC
PP0368 acdH1 -73 5.8 TTTCAAACAACTGTTTGATC
Pseudomonas syringae pv. tomato str. DC3000
PSPTO3508 psrA -31 5.6 TTTCAAACGTTCGTTTGTTA
PSPTO2192 null -68 4.8 TTTCAAACAAACGTTTTGAC
PSPTO3517 fadB -180 5.7 AATCAAACGGGCGTATGAAA
PSPTO2185 etfB -373 5.6 ATACAAACGTTTGTTTGAAT
PSPTO2726 null -89 5.8 TTTCAAACGAGCGTATGTTT
PSPTO1565 rpoS -427 4.8 CCTCAAACGGCAGTTTGAAT
PSPTO0134 algQ -180 5.3 TATTAAACGCTTGTATGAAC
PSPTO0500 acdH1 -113 5.6 TTTCAAACACCTGTTTGACC
Pseudomonas fluorescens Pf-5
PFL_1950 psrA -45 4.7 CCTGAAACGTATGTTTCAAA
PFL_1950 psrA -32 5.8 TTTCAAACAAGTGTTTGTCA
PFL_1826 null -76 4.5 TTTTAAACGGCTGTTTTAGC
PFL_1940 fadB -180 5.7 AATCAAACGGGCGTATGAAA
PFL_1819 etfB -393 5.6 ATACAAACGTTTGTTTGAAT
PFL_3668 null -88 5.7 TTTCAAACAAGCGTATGTTT
PFL_1818 etfD -176 5.9 ATTCAAACAAACGTTTGTAT
PFL_1207 rpoS -429 5.1 CTTCAAACGGTAGTTTGAAT
PFL_5997 algQ -183 5.1 GATTAAACGCTTGTATGAAC
PFL_5687 acdH1 -78 5.7 TTTCAAACAACTGTTTGACC
Pseudomonas mendocina ymp
Pmen_1588 psrA -44 5 GCTGAAACGTATGTTTCAAA
Pmen_1588 psrA -31 5.8 TTTCAAACAAGTGTTTGTCA
Pmen_1580 fadB -178 5.7 AATCAAACGGGCGTATGAAT
Pmen_2707 etfB -221 5.6 ATACAAACGTTTGTTTGAAT
Pmen_2708 etfD -123 5.9 ATTCAAACAAACGTTTGTAT
Pmen_3020 rpoS -424 4.8 CCTCAAACGGTAGTTTGAAT
Pmen_0285 algQ -269 5.2 GATTAAACGCTCGTATGAAA
Pmen_4081 acdH1 -125 5.9 TTTCAAACGCCTGTTTGATT
Pmen_2531 null -89 5.7 ATTCAAACAAGCGTATGTTT
Pseudomonas stutzeri A1501
PST_3860 acdH1 -71 4.7 GTCGAAACGTATGTTTCAAA
PST_3860 acdH1 -58 5.7 TTTCAAACGCCTGTTTGACC
PST_1735 psrA -32 5.6 TTTCAAACAGTTGTTTGTCT
PST_1726 fadB -155 5.7 AATCAAACGGGCGTATGAAT
PST_2241 null -146 5.6 ATTCAAACAAACGTTCGAAT
PST_2605 etfB -323 5.6 ATACAAACGTTTGTTTGAAT
PST_2607 etfD -130 5.9 ATTCAAACAAACGTTTGTAT
PST_1572 rpoS -421 4.8 CCTCAAACGGTAGTTTGAAT
Azotobacter vinelandii AvOP
Avin_38680 rpoS -422 4.8 CCTCAAACGGCAGTTTGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD