Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PuuR in Thermotogales

Properties
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Regulog: PuuR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Fervidobacterium nodosum Rt17-B1
Fnod_1327 speD -134 4.9 TTGTTCACTTAAGTAAACAT
Thermosipho africanus TCF52B
THA_1405 puuR -59 4.5 ATGTTCTGTATCATAGACAT
THA_1405 puuR -36 5.6 TTGTTCAGTATTATAGACAT
Thermosipho melanesiensis BI429
Tmel_0572 puuR -32 5.5 TTGTTTAGTATTATAGACAT
Thermotoga lettingae TMO
Tlet_0752 puuR -220 5.2 TTGTTGAGGATAATTGACAA
Tlet_0752 puuR -62 5.5 GTGATCAATATACTGGACAA
Thermotoga maritima MSB8
TM0656 puuR -58 4.8 ATGTCTGTGATACTGAACAA
TM0656 puuR -36 6.8 TTGTCAACTATAGTGGACAA
Thermotoga naphthophila RKU-10
Tnap_0452 puuR -58 4.8 ATGTCTGTGATACTGAACAA
Tnap_0452 puuR -36 6.8 TTGTCAACTATAGTGGACAA
Thermotoga neapolitana DSM 4359
CTN_0001 puuR -22 4.8 ATGTCTGTGATACTGAACAA
CTN_0001 puuR 0 6.4 TTGTCAACTATAGTGGTCAA
Thermotoga petrophila RKU-1
Tpet_0275 puuR -22 4.8 ATGTCTGTGATACTGAACAA
Tpet_0275 puuR 0 6.8 TTGTCAACTATAGTGGACAA
Thermotoga sp. RQ2
TRQ2_0273 puuR -58 4.8 ATGTCTGTGATACTGAACAA
TRQ2_0273 puuR -36 6.8 TTGTCAACTATAGTGGACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD