Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Streptococcaceae

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_1105 rplU -122 43.3 ATCCTGTGCAACCGCACGAACATCGTTGCTTGATTATTCAAGTTTAAGTGGTTCGTCCCACGATGCTAGGCGAGTCTTCACAAAAAATC
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1135 rplU -109 53.2 ACGTCCTGTGCAACCGCACGAAAATCGTTTTCAAGTAGATTGGCTCTCACGATTCTAGGCGAGTCTTCACAGAGGG
Streptococcus gordonii str. Challis substr. CH1
SGO_0818 rplU -124 41.5 TTCCTGTGCAACCGCACGAACATCGTTGCTCACATAGTGAGTATAAAGTGGTTCGTCCCACGATGCTAGGCGAGTCTTCACAAAAATAC
Streptococcus thermophilus CNRZ1066
str0417 rplU -116 47.4 GTCCTGTGCAACCGCACGACTACTGTTTTTGTAAGTGGGTTCGTCCCCGCAGTACTAGGCGAGTCTTCACAGAGGGAA
Streptococcus mutans UA159
SMU.846 rplU -109 52.6 ATCCTGTGCAACCGCACGAAAATCGCTTTTAAGCAGCTTTCGTAGCTCACGATTTAGGCGAGTCTTCACGGAGGAAT
Streptococcus pyogenes M1 GAS
SPy0819 rplU -108 50.1 ATCCTGTGCAACCGCGCGAAAATCGTTGTCAAGTAGACCAAGTCTCACGATTCCAGGCGAGTCTTCACAGAGGGAA
Streptococcus sanguinis SK36
SSA_1061 rplU -121 41 TTCCTGTGCAACCGCACGATCATCGTTGCTCACTCTGTGAGATAGAAGTGGTTCGTCCCACGATGCTAGGCGAGTCTTCACAAAATCCG
Streptococcus agalactiae 2603V/R
SAG1370 rplU -115 48.3 ACATCCTGTGCAACCGCGCGAAAATCGTTAGATTAAGTAGAGCAAGGCTCTCACGATTTATAGGCGAGTCTTCACAGAGGG
Streptococcus uberis 0140J
SUB0725 rplU -104 49.5 ATCCTGTGCAACCGCACGAAAATCGTTTAAGTAGAGAAATCTCACGATTCCAGGCGAGTCTTCACAGAGGGAA
Lactococcus lactis subsp. cremoris SK11
LACR_1180 rplU -112 42.7 ATAAAGTGCAACCGCACGAAGTTTCGTAATAAGTGGCGTAAGCCCACGAACAAAGGCGAGTCTAACAGTCGCTTG
Lactococcus lactis subsp. lactis Il1403
L0417 rplU -112 43 ATAAAGTGCAACCGCACGAAGTTTCGTATTAAGTGGCATACGCCCACGAACAAAGGCGAGTCTAACAGTCGCTTG
Streptococcus suis 05ZYH33
SSU05_0781 rplU -48 42.6 ATCCTGTGCAACCGCACGAATGCCGTTCTTTCGTTGAGAGTAGAGTAAGTGGTTCGTCCCACGGTACTAGGCGAGTCTTCACATCAAATT
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0786 rplU -108 52 ATCCTGTGCAACCGCACGAAAATCGTTGTCAAGTAGACCAAGTCTCACGATTCCAGGCGAGTCTTCACAGAGGGAA
Streptococcus gallolyticus UCN34
GALLO_1343 rplU -111 51.8 ACATCCTGTGCAACCGCACGAAAATCGTTCGTAAGTAACTTTCGAAGTTCACGATTTAGGCGAGTCTTCACAAGCGG
Streptococcus mitis B6
smi_0926 rplU -123 43.3 ATCCTGTGCAACCGCACGAACATCGTTGCTTGATTATTCAAGTTTAAGTGGTTCGTCCCACGATGCTAGGCGAGTCTTCACAAAAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD