Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Lactobacillaceae

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Oenococcus oeni PSU-1
OEOE_0957 rplU -75 38.8 CAATGCTTCAACCACTCTAAAGCGGTTTTTAAGTGATTTATCACACCGCCACGGTGAGTCTAAGAGGAGGCCT
Lactobacillus reuteri JCM 1112
LAR_1124 rplU -89 50.6 CCAACAACTACAACCGCACGTTATTAAGTCTAAAGCTTATTTAGCTGCTTAGTACGGCGAGTCTGAGATATTAA
Lactobacillus helveticus DPC 4571
lhv_1424 rplU -96 57.4 TCCACATCTGCAACCGCACGGCTCGGGGTTAGAAGTCTTCTTGAGTAAGAAGCACCTCAGTTCGGCGAGTCTAAGTATTTTT
Lactobacillus fermentum IFO 3956
LAF_1269 rplU -83 50.4 CCCACAACTACAACCGCACGATGGCGAGTTTAAAAGCATTCGCTACTCGTCTTGGCGAGTCTTAATTTAAGG
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0956 rplU -95 59 ATCACATCTGCAACCGCACGTTTTAAGTTTAAGTATCTCTTTAGAGGTCACTACATTACGGCGAGTCTAAGTATTTTA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1326 rplU -94 62.2 CTCGATTCTGCAACCGCGCAGATAAGGTTGACAAGCCTGCTTTGGGCAGCACCTTTGATGGCGAGTCTAAGTAATTTT
Lactobacillus acidophilus NCFM
LBA1338 rplU -95 61.2 TCCACATCTGCAACCGCACGGCTAGGGTTAGAAGACTTCTTGAGTAAGAAGCACCCCAGTTCGGCGAGTCTAAGTATTTTT
Lactobacillus johnsonii NCC 533
LJ1556 rplU -96 60.2 CTCACATCTGCAACCGCACGTTTATGAGGTTAGAAGAGAATTAACGTTAATTCCACCTCATGCGGCGAGTCTAAGTATTTTT
Lactobacillus plantarum WCFS1
lp_1592 rplU -95 53.9 TACAGCTACAACCGCACGGATTGAGTCTTAAGATCAGCAATGGCACTTACATTCGGCGAGTCTAAGTGATTTATA
Lactobacillus casei ATCC 334
LSEI_1646 rplU -101 45.2 CCCTCCTATGCAACCGCACAATGTTGGGTTTTTAAGCGTAAGCACCCAACTTGGCGAGTCTTCAGGGGAAA
Lactobacillus brevis ATCC 367
LVIS_0985 rplU -99 61.4 TCCACAGCTGCAACCGCTCGGAACGAGTTTAAGTTTTCCGCTTGCGGAGCACTTGTCTTCGGCGAGTCTAAGTCTAAAA
Lactobacillus sakei subsp. sakei 23K
LSA0670 rplU -88 62.6 CACAGCTGCAACCGCGCATACTAAGGCATTAAGTACTATTATTAGTCACCTTAGTTGGCGAGTCTAAGAAAAAATAG
Pediococcus pentosaceus ATCC 25745
PEPE_0811 rplU -79 57.9 CCACGCTACAACCGCACAAAGTGAGTTTTAAAGCATAGCACTTACTTTGGCGAGTCTTAGAATTAAGGA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_1326 rplU -96 46.3 AGCATAGCTACAACCACTCAGAACAGGTCAAAGCATGCTCGGGACAAGGGCCCGACCGCCTGTGATGGTGAGTCTAAGTATAAGG
Lactobacillus rhamnosus GG
LGG_01690 rplU -100 42.6 CCCTCCTATGCAACCGCACATCGTTAGGTTTTAAGCGCAAGCACCTAACTTGGCGAGTCTTCAGGGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD