Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Rex in Desulfovibrionales

Properties
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfohalobium retbaense DSM 5692
Dret_1683 adk -29 4.8 TTTGTGAAATTTTTCTTCAG
Dret_2089 atpI1 -11 4.6 CTTGTGAATGAATGCACGAA
Dret_2085 rex -19 4.5 ATTGTGAAATTTAGAGCAAA
Dret_1967 apsB -167 4.4 CTTGCGCTAAATTTCACTTT
Dret_0270 qrcA -102 4.7 CTCGTGAAATTGTGCACAGG
Dret_0270 qrcA -176 4.8 ATCGTGAAATTTTTCATGAG
Dret_0234 null -70 3.8 AATGTGAAATTCGGCACACA
Dret_1968 sat -273 4.8 CTTGTGCAATAGCGCACAAG
Dret_1968 sat -130 5.1 ATTGATAAAAAAATCACAAA
Dret_1594 ppaC -84 5.3 TTTGTGCTATTTGGCACAAA
Dret_0244 dsrA -109 4.1 GTTGTACGAAAAATCACAAT
Dret_2217 atpF1 -35 4.3 TTTGAACCAAAATTCACATA
Desulfomicrobium baculatum DSM 4028
Dbac_3197 apsB -95 5.2 TTTGATAAAAGATTCACAAG
Dbac_0784 adk -31 5.2 TTTGTGAAATTTTTTACAGG
Dbac_3196 sat -43 4.9 TTTGTGAAAATAAAAACAAA
Dbac_0143 ppaC -58 5.3 ATTGTGATATTTAGCACAAT
Dbac_2797 atpI1 -56 5.1 TTTGTGATTTATTGCACGAA
Dbac_2793 rex -39 4.4 TTAGTGAAATAACTCACGAA
Dbac_3390 qrcA -116 4.5 ATCGTGATTTTTTTCATTAT
Dbac_0269 null -134 4.9 CTTGTTTCATTTTTCACAAA
Dbac_3196 sat -114 4.8 GTTGATAAAAAAATCACAAA
Dbac_3361 atpF1 -36 4.9 TTTGAACAAAAATTCACAAC
Desulfovibrio desulfuricans G20
Dde_0526 dsrA -153 4.2 TTTGTCCAAAAAATCACGTA
Dde_2702 rex -48 5 CTCGTTATTTATTTCACATT
Dde_2698 atpI1 -68 4.1 CTTGTGAAGGAATGCACGAA
Dde_2698 atpI1 -151 4.8 CTTGTGAAAAATTTCTAAAA
Dde_1778 ppaC -78 5.2 ATTGTGCTATTTGGCACAAA
Dde_2932 qrcA -110 5 TTCGTGAATTTTTTCACCTT
Dde_1109 apsB -188 5.6 TTTGTTAAATATCTCACAAG
Dde_0990 atpF1 -38 4.9 TTTGAGCTTAAATTCACAAC
Dde_2028 adk -12 5.1 TTCGTGAAATAAATGACAAG
Dde_2265 sat -149 5.5 TTTGCTAAAAATTTCACAAG
Dde_2506 null -145 4.7 TACGTTAAAAAAATCACAAT
Dde_1076 phsA -114 5.2 ATTGTGCTTTTTTGCACAAT
Dde_2134 hysB -48 4.2 TTTGTAAAACTGTGCACAGG
Dde_0990 atpF1 -121 5 TTCAGGAAATTTTTCACAAG
Dde_2270 null -167 4 TATGTGAAAAAAATAATTAT
Dde_0580 dhcA -226 4.4 TATGTGAAAAATTTAATTAG
Dde_1140 null -107 4.5 CATGTGAAATTTTTCCCGAA
Dde_0552 null -33 5.3 CTTGGGAAATTTTGCACAAC
Dde_1591 null -83 4.9 ATTGTGCATTATTTAACTAG
Dde_2058 hupB -106 4.8 CTTGAGAAAAAAATCTCAAA
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_2130 apsB -140 4.4 CTTGTTACTAATTGCGCAAG
Ddes_0454 sat -108 5.4 TTTGTTAGATTATTCACAAG
Ddes_1880 cooM -110 4.3 TTTACTATTTTTTTCACGAT
Ddes_0968 ppaC -70 4.4 TTTGTGCTAAAGAGTACAAA
Ddes_1956 adk -51 4.6 TGTGTTCTTTTTTGCACAAT
Ddes_1237 dhcA -214 4.6 ACTGTGAAAAATATCACCAA
Ddes_0921 dsrA -209 4 ATTTTTAAATATAAAACAAA
Ddes_2183 atpF1 -113 5 CTTGCGAAATTTGTCACCAA
Desulfovibrio magneticus RS-1
DMR_16390 adk -32 4.3 ATTGTGAAAAATCAAACATG
DMR_42140 atpI1 -76 4.4 CTTGTGAACTTGTGCACGAG
DMR_05390 apsB -279 4.4 CTTGTTAAACCGATCACAAG
DMR_02450 hycA -133 5.7 TTTGTGAAAATAATCACAAA
DMR_18010 qrcA -217 5 TTCGTGAATTTTTTCATTAG
DMR_39470 sat -140 4.2 TTTGACACATTTTTCACTTG
DMR_25800 ppaC -79 5.3 ATTGGGATATTATTCACAAG
DMR_03600 dsrA -166 4.1 ATTGTTCAAAACTTCACGTT
DMR_04760 atpF1 -163 4.6 TTCGGTCAATTCTTCACAAA
DMR_04760 atpF1 -36 5.1 TTTGCAAAAATTTTCACAAC
Desulfovibrio piger ATCC 29098
DESPIG_02071 atpI1 -11 4.7 ATTGTGATAATTTGTACATT
DESPIG_02241 sat -82 5.4 TTTGTTAGATTATTCACAAG
DESPIG_02774 apsB -142 4.4 CTTGTTACTAAAAACACAAG
DESPIG_01072 ppaC -101 4.6 CTTGTGCTAAAGGTAACAAG
DESPIG_01460 adk -55 4.7 TCTGTTCTTTTTTGCACAAA
DESPIG_02016 atpF1 -99 5 TTTGCGAATTTTGTCACCAA
Desulfovibrio salexigens DSM 2638
Desal_1973 adk -39 5.1 TTTGTGAAATTTGTTACTAA
Desal_3727 atpI1 -74 4.1 CTTGTGAAGGTTTGCGCAAA
Desal_0228 sat -242 4.6 CTTGACATTTCTTTCACAAA
Desal_0229 apsB -146 4.7 CTTGTTCTAAATTTCACTTT
Desal_2181 null -173 5 CTTGGGAATTAAAGCACAAA
Desal_2447 null -144 4.7 TGTGTGAAAATTTTCCCAAT
Desal_2447 null -275 4.7 TTTGTGCAAAAATTACCAAA
Desal_2050 hysB 21 4.7 TTCGTGAAAATGTGCACAGG
Desal_2248 ppaC -57 4.5 ATTGTGATAGAAGACACAAG
Desal_0187 null -118 3.9 AGTGTGACAGAATTCACATT
Desal_1042 qrcA -112 4.8 TTTGTGAAAAGTTTCATATT
Desal_0787 dsrA -177 4.2 GTTGTGTTTTTTTTCACTTA
Desal_3459 atpF1 -150 4.5 TTAGTTAAAAAAATAACAAG
Desal_3459 atpF1 -36 4.8 TTTGGACAAAAATTCACAAC
Desulfovibrio vulgaris Hildenborough
DVU1636 ppaC -79 5.2 ATTGTGCTATTTGGCACAAA
DVU0846 apsB -168 4.6 ATTGTTAATTCCATCACAAG
DVU2286 cooM -116 4.4 ATTGGGAATCGATTCACAAA
DVU0780 atpF1 -59 5 TTTGAGCTTTAATTCACAAC
DVU1932 adk -30 5 CTCGTGAAATTAATGACAAG
DVU1295 sat -150 5.7 TTTGTAAATTTTTTCACAAG
DVU1917 hysB -288 4.1 CGAGCTATATATTTCACAAA
DVU0694 qrcB -755 5.1 TTCGTGAAATATTTCACCTT
DVU1292 null -40 4.1 TATGTGAAAAAAATCATTTT
DVU0920 atpI 61 4.2 CTTGTGAACGATTGCACGAA
DVU2791 dhcA -127 4 CTTGTGAAATAATGTTCTTT
DVU0402 dsrA -155 4.5 TTTGTCCAAAAAATCACGAG
DVU1795 hupB -113 4.5 TTTGGGAAAAAAAGCGCAAG
null null -54 4.1 CTTGTGGTGTTTTACACAAA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_1386 atpI1 -76 4.3 CTTGTGAACGTTTGCACGAA
DvMF_1386 atpI1 -148 4.1 GTGGGGAATTTTTTCACGAA
DvMF_2892 apsB -171 5.1 ATTGTTAAATCAGTCACAAG
DvMF_2826 atpF1 -38 4.9 TTTGAGCTTAAATTCACAAC
DvMF_0293 adk -30 5.1 CTCGTGAAAATTATTACAAG
DvMF_0320 phsA -175 4.5 ATCGTGATTGTTTTCACGAA
DvMF_0274 hysB 21 4.2 TTCGTCAAATTGTGCACAGG
DvMF_2690 qrcA -112 5.1 TTCGTGAAATATTTCACCTT
DvMF_0420 ppaC -92 5.3 TTTGTGCTATTTGGCACAAA
DvMF_0074 sat -164 5.4 TATGTAAAATATTTCACAAG
DvMF_1553 dsrA -151 4.5 TTTGTCCAAAAAATCACGAG
DvMF_0500 hupB -96 4.5 CTTGAGAAAAAAGGCGCAAA
Lawsonia intracellularis PHE/MN1-00
LI0399 atpF2 -171 4.7 TATGTTAAATGAAGCACAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD