Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Streptococcaceae

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_0959 infC -119 71.8 GAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGTGACATTAAGTTGCCTGGCCCTACGGATGAAAAGTTTCGAAGAAACGCTATCATAACGTGCGGGCTTGTATATTTACAAGTCCGCTATTGTTTTTCTCTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0857 infC -136 72 GAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGCGACCTAGGTTGTCTGGCCCTACATGTCAAATTCCTATGGGATATTATGTGTGCGGGCTTGATTCATTAAGTCCGCTTTCGTTTTTCTCTAA
Streptococcus gordonii str. Challis substr. CH1
SGO_1032 infC -244 76.9 GAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGCGACTAACGTTGTCTGGCTCTACGGATTAAGTTTCAGTAATGAAATACTATCATGTAGTGCGGGCTTGCGTTAGCAAGTCCGCTCTTGTTTTTCTCGAA
Streptococcus thermophilus CNRZ1066
str1134 infC -137 77.3 ATGAGAAAAGCAGAAGTGAGAACTTCTCGCCTTGCGACTTAGGTTGTCTGGCCCAACATGTCAAATCCTTAAAGGGATATTATGTGTGCGGGCTTGTATATCAAGTCCGCTTTGTTTTTCTCTA
Streptococcus mutans UA159
SMU.697 infC -142 77.6 GAGAAAAGCAGAAGTGAGAACTTCTCGCCTTGCGACTTAAAGTTGTCTGGCCCAACATGTTAAAGTTCCTGTGGAATATTATGTGTATACGGGCTTGATTTGTCAGGTCCGTTTTTGTTTTTCTCAAA
Streptococcus pyogenes M1 GAS
SPy0804 infC -137 77.8 GAGAAAAGTAGAAGTGAGAGCTTCTCGCCTTGCGACTTAGGTTGTCTGGCCCTAACATGTCAAATTCCTATGGAATATTATGTGTGCGGGCTTGATTTATCAAGTCCGCTTTCGTTTTTCTCTAA
Streptococcus sanguinis SK36
SSA_1500 infC -148 76 TTGAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGCGACTAACGTTGTCTGGCTCTACAGGATTCAGTTTCAGTAATGAAATATTATCGTGTAGTGCGGGTTTGCGTTAGCAGGTCCGCACTTGTTTTTCTCT
Streptococcus agalactiae 2603V/R
SAG1384 infC -141 83.7 ATGAGAAAAGCAGAAGTGAGAACTTCTCGCCTTGCGACTTAGGTTGTCTGGCCCAACATGTCAAGATTCCATCTAGGAAGATTATATGTGCGGGCTTGATTTATCAAGTCCGCTTTCGTTTTTCTCT
Streptococcus uberis 0140J
SUB0711 infC -138 79.8 GAGAAAAGTAGAAGTGAGAGCTTCTCGCCTTGCGACTTAGGTTGTCTGGCCCAACATGTCAAAATCCAATTTGGATATTTATGTGTGCGGGCTTGATTTATCAAGTCCGCTTTCGTTTTTCTCTAA
Lactococcus lactis subsp. cremoris SK11
LACR_2033 infC -58 81.7 AGTTGAAAAGCAGAAGCACCCGCTTCTCGCCTTAGAGGTTATAGCCCTGGGCAAACAAATGGAATTATTCAAAAACGAATGTTTTCATGAGCGGGGCGAGATTGTCGTTCCGCTTTTGTTTTTCTTT
Lactococcus lactis subsp. lactis Il1403
L95240 infC -213 80.3 AGTTGAAAAGCAGAAGCACCCGCTTCTCGCCTTAGAGGTTATAGCCCTGGGCAAACGAATGGAATTATTCAAAAACGAATGTTTTCATGAGCGGGGCGAGATTGTCGTTCCGCTTTTGTTTTTCTTT
Streptococcus suis 05ZYH33
SSU05_1270 infC -170 66.7 TTGAGAAAAGCAGAAGTGAGAACTTCTCGCCTTGCGACTAACGTTGTCTGGCTCTACGGATTAAGATTTCTTCGGAAAGAATAATGGTGTAGTGCGGACTTGTTTAGCAAGTCCGTTTCGTTTTTCTCGA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0770 infC -137 77.6 GAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGCGACTTAGGTTGTCTGGCCCTAACATGTCAAATTCCTACGGAATATTATGTGTGCGGGCTTGATTTATCAAGTCCGCTTTCGTTTTTCTCTAA
Streptococcus gallolyticus UCN34
GALLO_1361 infC -143 74.1 ATGAGAAAAGCAGAAGTGAGAACTTCTCGCCTTGCGACTAAGGTTGTCTGGCCCAACATGTCAAAGATTCCTTCGGGAATACTATGTATGTACGGGCTTGGTTTGTCAAGTCCGTTTTTGTTTTTCTCT
Streptococcus mitis B6
smi_0959 infC -119 66.6 GAGAAAAGCAGAAGTGAGAGCTTCTCGCCTTGTGACATTAAGTTGCCTGGCCCTACGGATGAAAAGTTTCTAAGAAACGCTATCATAACGTGCGGGCTTGTATTATTACGAGTCCGTTATTGTTTTTCTCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD