Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Lactobacillaceae

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Oenococcus oeni PSU-1
OEOE_1280 infC -85 29.5 TTGAATTAAGTAGAGGTTCCCGCCTCTCGCCGCATGTGCAAGACCATGTTGGCTTATCATTCTTTTTGAGGCGGGTTTTGCATGTTTGCATGACTCGCTTTTTCCAACCA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_1443 infC -246 57.7 GTTGAACAAGTAGAAGCACCCGCTTCTCGCCAAGTGACTATGTTGCTTGGCAGATACAGTTGTACGAAAGTACTGCAAGTGTGGAAGTGGGTAAAGATTAAGTTCTTGGCCCACTTTTCTTCTTGA
Pediococcus pentosaceus ATCC 25745
PEPE_0699 infC -168 70.7 AGAAAAAGCAGAAGCCACCGCTTCTCGCCTTGTAACTTAAGTTGCTGGGCTAAAGAACGTTGAATGGATACTAATTAATTATCCAAACAAAGCGGGTGGCGTATGCCATCCGCTTTTCTGCATTCTCGC
Lactobacillus sakei subsp. sakei 23K
LSA1398 infC -189 57.7 AGAAATAAAGCAGAAGTTCCCGCTTCTCGCCTTAGTAGACACTTGATGTCTCTGGGCTGATAGTTTCTAATTCGGACGAATTAAGTTATCGAATAGCGGGCCTTTCTGTTGAAGGGGCCGTTTTTTTGGTGCT
Lactobacillus brevis ATCC 367
LVIS_1035 infC -235 50.8 AGAAATTAAGCAGAGGCTTCCGCTTCTCGCCTTATGACTAACGTTATTGGGCTGGATATGCACGTTAATGTCGTCTTCGTGATGACATTTCTTGCGGGAGCCGTTTGATTCTGATCAAAGGTTCCCGCATTTTTTGTGAGTG
Lactobacillus casei ATCC 334
LSEI_1699 infC -192 52.5 TGAGAAAAAGCAGAAGTTCCCGCTTCTCGCCTAAGTCCTTGGACCGCTAGGCTCATTAGTTCGGTATTTAATGAACAGCGGGGTCTTTGTGGCCACGCTGTTTTTGTTTTTT
Lactobacillus plantarum WCFS1
lp_1515 infC -146 88.8 AAAAAAAGCAGAAGCACCCGCTTCTCGCCTTGGTGACCAGAGTCATCGGGCAGATGAACGATGAATTGATTCCCATTAACGGGGTTGAGCGGGCGTACTATGCGCCCGCTCTTTTTGTGAATTTC
Lactobacillus johnsonii NCC 533
LJ1641 infC -152 66.9 TGAGAACAAGAAGAAGCTCCCGCTTCTCGCCTAAGTTAATATTACCTCTGGGCTGATCGATAATATCTGTTGATTAAAAGCGGGCGTTAACTTTGCCCGCTTTTTTCTTGTCCT
Lactobacillus acidophilus NCFM
LBA1538 infC -220 74.7 TGAGAACAAGAAGAAGCACCCGCTTCTCGCCTAAGTTAAGTAAACCTCTAGGCTGATCGATAATTTCTGTTGATTAAAGGCGGGGTGATACTTATCCCGCCTTTTTCTTGTCCT
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1398 infC -160 67.2 TGAGAACAAGAAGAAGCCCCCGCTTCTCGCCTAAGTTATTTAACCTCTGGGCAAATCGATATTTTCTGTTGATTTTAAAGGCGGGTGCTATATGCCCGCCTTTTTCTTGTCCT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0495 infC -154 56.1 AGAAAAAGCAGAGGCACCCGCTTCTCGCCTAGGAAATGTAGGTTTCCGGGCAGAAATTATGATATTAATTCTAATTAAAACGGATTATTAAGACGGGCATTCTGATTTTTTGGATGTCCGTTTTCTGCATTTTCTCT
Lactobacillus fermentum IFO 3956
LAF_1311 infC -181 60.4 AAAGAAAAAGTAGAAGCACCCGCTTCTCGCCTAGGTGATTGGAGTCGCCGGGCTGACGAGATTAAATCCGAATGACCATTATGGTTAGTTCGCTTTGCGGGGGTGTGTGTGCACTCCCGTTTTTTCTTGCTTAA
Lactobacillus helveticus DPC 4571
lhv_1598 infC -315 61.4 TGAGAACAAGAAGAAGCTCCCGCTTCTCGCCTAAGTTAAGTAAACCTCTGGGCTGATCGATAATTTCTGTTGATTAGAGGCGGGTGATACTTATCCCGCCTTTTTCTTGTCCT
Lactobacillus reuteri JCM 1112
LAR_1175 infC -180 57.8 AAAGAAAAAGCAGAAGCACCCGCTTCTCGCCTAGGTGGTATTGATCGCCGGGCTGACGAGATGAATGATAATCGACCACTAGGATAAGGTCGTTGTTATGAAGCGGGGTACTTTTGTGCCTCGCTTTTTTGCTTGATC
Lactobacillus rhamnosus GG
LGG_01747 infC -192 52.2 TGAGAAAAAGCAGAAGTTCCCGCTTCTCGCCCAAGTCTTTAGACCTCTAGGCTCATTAGTTCGGTATTTAATGAACAGCGGGGCCTTTGTGGCTACGCTGTTTTTGTTTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD