Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L19_leader in Streptococcaceae

Properties
Regulator family: RF00556
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L19_leader - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_1293 rplS -54 34.3 ACAGTTTATCCGCTGAGGAAGATTCCTCAAGATTGACAA
Streptococcus gallolyticus UCN34
GALLO_1479 rplS -55 21.1 ACGGCTAATCCGCTGGGACAAGCACCTAATGATTAGTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0696 rplS -51 26.4 GGCTAATCCGCTAAGACAAGTACTTAAGATTAGTAAGA
Streptococcus suis 05ZYH33
SSU05_0352 rplS -54 23.6 AGTTTATCCGCTGGGTTTAAAAGCACCTAAGATTGACAAAG
Lactococcus lactis subsp. cremoris SK11
LACR_0945 rplS -60 18.3 TGTTCATCCGCTGAGCTTAATTTGCTAAAAGCTGCTTATGATGGGCAAGA
Streptococcus uberis 0140J
SUB0644 rplS -52 24.3 GGCTAATCCGCTGGGACAAGTACTTATGATTAGTAAGA
Streptococcus agalactiae 2603V/R
SAG0544 rplS -52 28.8 GGCTAATCCGCTGAGACAAGTACTTAAGATTAGTAAGA
Streptococcus sanguinis SK36
SSA_1265 rplS -20 25.4 ACGACTAATCCGCTGCGGTCATGAACCTTAAGATTAGTAA
Streptococcus pyogenes M1 GAS
SPy0724 rplS -51 26.4 GGCTAATCCGCTAAGACAAGTACTTAAGATTAGTAAGA
Streptococcus mutans UA159
SMU.1288 rplS -56 28.8 ACGGCTAATCCGCTGAGACAGAGCACTTATGATTAGTAA
Streptococcus thermophilus CNRZ1066
str1179 rplS -62 28.2 ACGGCTAATCCGCTGAGACACAGAGGTTGCTCTTAAGATTAGTAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0754 rplS -53 24.3 GGCTAATCCGCTAAGACTCGCACTTAAGATTAGTAAGA
Streptococcus mitis B6
smi_1265 rplS -54 30 ACAGTTTATCCGCTGAGGAGGGTGCCTCAAGATTGACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD