Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L19_leader in Lactobacillaceae

Properties
Regulator family: RF00556
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L19_leader - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0607 rplS -63 25.5 CGATAATCCGCTGTGCGTTTAGCCTAAGGGCAAGTGTATGATTGTCGATC
Pediococcus pentosaceus ATCC 25745
PEPE_0850 rplS -57 20.5 CAATGTTCCGCTGGCTCCGGGTGAGTTAATGAAGATTGGCG
Lactobacillus sakei subsp. sakei 23K
LSA0719 rplS -56 32.3 CGATATTCCGCTGGCGCAAGACGTTAATGAATATCTGTG
Lactobacillus brevis ATCC 367
LVIS_0939 rplS -58 25.4 AACAACATTCCGCTGTCGAACCTGAGGATGAATGTTGG
Lactobacillus casei ATCC 334
LSEI_1597 rplS -54 32.3 AACGACATTCCGCTGGTCGGGATGATTATGAATGTCGG
Lactobacillus plantarum WCFS1
lp_1640 rplS -54 35.3 CGATGTTCCGCTGACCAGGTTGTCACGAATGTCGGCG
Lactobacillus johnsonii NCC 533
LJ1512 rplS -55 24.4 ATGGGTATTCCGCTGGCACAAGGTGTTGATGAATGCCGT
Lactobacillus acidophilus NCFM
LBA1286 rplS -59 31.5 ATGGGTATTCCGCTGACGCTGGTACGTTGATGAATGCCGA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1273 rplS -56 23 ATGGGTGTTCCGCTGGCCCAGAGAGGTTGATGAATGCCGT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0636 rplS -50 30.2 CGATATTCCGCTGCAACTGGACATGAATGTCGGTG
Lactobacillus fermentum IFO 3956
LAF_1219 rplS -59 25.9 AACGGTATTCCGCTGGTTCCAAGGGAATTAATGAATGTCGG
Lactobacillus helveticus DPC 4571
lhv_1368 rplS -59 18.7 ATGGGTGTTCCGCTGGCGCTGGTGCGTGAATGAATGCCGA
Lactobacillus reuteri JCM 1112
LAR_1082 rplS -61 30.4 AACGGTATTCCGCTGCCCGTCATACAGGACATGAATGTCGG
Lactobacillus rhamnosus GG
LGG_01639 rplS -54 29.1 AACGGCATTCCGCTGGTCGGGATGATTATGAATGTCGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD