Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L13_leader in Streptococcaceae

Properties
Regulator family: RF00555
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L13_leader - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_0294 rplM -106 56 GTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACTTTTCGATGGGAAGGAACACCCATCACCGTAAACAAAAATC
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1746 rplM -126 55.3 CGGTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACCTTCGATGGACCGGAACATCCATCACTAATGTAAACAAAAA
Streptococcus gordonii str. Challis substr. CH1
SGO_0358 rplM -101 56.5 GTATTGTTTACCCCATTTGTAAGGCCCCGGAACCTTTCAAATAACTTGCGGACCGGAACATCCGCCCTGTAAACAAAAACG
Streptococcus thermophilus CNRZ1066
str0093 rplM -109 56.4 GTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATATACTTTTCGATGGGAAGGGACACCCATCACTCGTAAACAAAAATC
Streptococcus mutans UA159
SMU.169 rplM -98 55.8 GTATTGTTTGCCCCATTTGAAAGGCCCCGGAACCCTTCAAATAATTTGTGGACCGGAACATCCACATTGTAAACATAAAGA
Streptococcus pyogenes M1 GAS
SPy1932 rplM -110 54.2 CGGTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACCTTCGATGGGACGGAACACCCATCACCTTGTAAACAAATA
Streptococcus sanguinis SK36
SSA_2034 rplM -101 55.8 CGGTATTGTTTACCCCATTTGTAAGGCCCCGGAACCTTTCAAATAACTCGCGGACCGGAACATCCGCCCTGTAAACAAAAA
Streptococcus agalactiae 2603V/R
SAG0214 rplM -102 57.4 GTATTGTTTACCCCATTTGTAAGGCCCCGGAACCTTTCAAATACTCTCGTGGACCGGAACATCCACACCTGTAAACAAAAACG
Streptococcus uberis 0140J
SUB0276 rplM -111 53.6 GTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACCCTTTGATGGGACGGAACACCCATCAACACTTGTAAACAAATATT
Lactococcus lactis subsp. cremoris SK11
LACR_2584 rplM -103 52.5 CGGTATTGTTTACCCCATTTTTGTGGCCCCGGAAACCCAAAAATACTTTGCAGGACTCTTACACCTGCTGTAAACAAATT
Lactococcus lactis subsp. lactis Il1403
L0409 rplM -103 52.5 CGGTATTGTTTACCCCATTTTTGTGGCCCCGGAAACCCAAAAATACTTTGCAGGACTCTTACACCTGCTGTAAACAAATT
Streptococcus suis 05ZYH33
SSU05_1898 rplM -100 54.1 TGGTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACCCGCGGACCGGAACATCCGCCCAGTAAACAAAAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0277 rplM -3 53.9 GTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACCTTCGATGGGACGGAACACCCATCACCCTGTAAACAAATATT
Streptococcus gallolyticus UCN34
GALLO_0233 rplM -102 54.9 GTATTGTTTACCCCATTTGTAAGGCCCCGGAACCTTTCAAATAACTCGTGGACCGGAACATCCACACTTTGTAAACAAAAACG
Streptococcus mitis B6
smi_1797 rplM -108 56 CGGTATTGTTTACCCCATTTGAAAGGCCCCGGAACCTTCCAAATACTTTTCGATGGGAAGGAACACCCATCACCGTAAACAAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD