Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L13_leader in Lactobacillaceae

Properties
Regulator family: RF00555
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L13_leader - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0230 rplM -95 55.2 GTATTGTTTACCTCACGATAAGCCCCGGAAACTTATTGTAAATGCTTGGCAAGGAACGGCTGAGTCAGTAAACAACTAAT
Pediococcus pentosaceus ATCC 25745
PEPE_1386 rplM -82 47.7 TGGTATTGTTTACCTCCACAAAATAAGCCCCGGAAACTTATTAAAGTTGAGTTAAACAAAAC
Lactobacillus sakei subsp. sakei 23K
LSA1722 rplM -77 61.4 TGGTATTGTTTGCCCCACGATAGGCCCCGGAAACTTATTGAGTGTCAAACAAACACAGA
Lactobacillus brevis ATCC 367
LVIS_1658 rplM -78 40.2 TGGTATTGTTTGCCCCACGATAAGCCCCGGAAAGTTTACTTGGTGTCAGACAAACACAGA
Lactobacillus casei ATCC 334
LSEI_2463 rplM -77 59.6 TGGTATTGTTTGCCCCACGATAAGCCCCGGAAACTTAACGTGTTCAAACAAGCACAGA
Lactobacillus plantarum WCFS1
lp_1077 rplM -75 58.1 GTATTGTTTGCCCCACGATAAGCCCCGGAAATCTTATTGAGTGTCAAACAAACACAGAAA
Lactobacillus johnsonii NCC 533
LJ0367 rplM -70 45.8 GTATGTTTGTCCACGATAGGCCCCGGAAACTTATTGTTTGTCAAACAGAAGAAAAA
Lactobacillus acidophilus NCFM
LBA0323 rplM -69 46.6 GTATGTTTGTCCACGATAGGCCCCGGAAACTTATTGTTTTCAAACTGCAAATA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0382 rplM -121 43.6 GTATGTTTGTCCACGGTAGGCCCCGGAAACTTATTGTATTCAAACTACGAATT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1403 rplM -79 46.8 TGGTATTGTTTGCCCCACAGTAAGCCCCGTTAATCTTATTGTATGTCAAACATGTA
Lactobacillus helveticus DPC 4571
lhv_0343 rplM -69 46.6 GTATGTTTGTCCACGATAGGCCCCGGAAACTTATTGTTTTCAAACTGCAAATA
Lactobacillus reuteri JCM 1112
LAR_1362 rplM -74 19.9 TGGTATTTCTTTTCCATCTAATAACTCGGTACACTATTATATGTAAAAGAAAAAC
Lactobacillus rhamnosus GG
LGG_02448 rplM -77 59.6 TGGTATTGTTTGCCCCACGATAAGCCCCGGAAACTTAACGTGTTCAAACAAGCACAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD