Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Streptococcaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_0408 glyP -178 58.7 GACGGAACTCTGGAGAGACCGTAAAGGCACCGAAGGGGCAAGGCAGGCAACTGCTCAAACTCTCAGGTAAAAGGACAGAGCTAGGATAGA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0890 glyP -216 67.4 TGGACGGGCTTCTGGAGAGACCTATTAGGCGCCGAAGGGGCAAGGCAAGACTGCTCAATCTCTCAGGCAAAAGGACAGAAGATAAAAT
Sez_0890 glyP -297 23 ATGATGTCATGCAGGAGAAGAATGGATTTCGCCGAAGGAGTTATACTCTCAGGTGTTCAGGTGTTGGACGGGACTGCTTGAT
Streptococcus thermophilus CNRZ1066
str0984 glyP -202 65.6 TTGACGGACTTCTGGAGAGATCTTGAAACGGCTTATGCTGTAGACAAGACACCGAAGGGGCAAGGGATAAGACCCGAAACTCTCAGGTAAAAGGACAGAAAGCATTGA
Streptococcus mutans UA159
SMU.1175 glyP -195 65 GACGGACTTCTGGAGAGACCTACTAGGCGCCGAAGGGGCAAGGCTGTTTGCTCAAACTCTCAGGCAAAAGGACAGAAAAGAAAAAAA
Streptococcus pyogenes M1 GAS
SPy1270 glyP -294 22.5 GATGTCATGCAGGAGAAGAATTTTTTTCGCCGAAGGAGTTATACTCTCAGGTGTTCAGTTTTTGAACGGGACTGTTTGATGG
SPy1270 glyP -213 70.6 GACGGACTTCTGGAGAGACCTTATTAGGCGCCGAAGGGGCAAGGCATACTGCTCAATCTCTCAGGCAAAAGGACAGAAGGTAAAATAC
Streptococcus sanguinis SK36
SSA_0363 glyP -177 60 GACGGAACTCTGGAGAGACCATGAATGGCACCGAAGGGGCAAGGCGGTTTAGAACCGCTCAAACTCTCAGGTAAAAGGACAGAGCGAAGAGGCA
Streptococcus agalactiae 2603V/R
SAG1145 glyP -368 30.9 GACGTCATTCAGGAGAAGAAAGTTAGACTTTCGCCGAAGGAATTACACTCTCAGGTGTCTTAAGACAGGACTGATTGACAG
SAG1145 glyP -288 66.8 GACGGACTTCTGGAGAGACCTATAAGTAGCAACATCTTTGTATTGACACCAAGATGTGCTCTAGGCGCCGAAGGGGCAAGAAGAGTAAAACAACTCCTCCAATCTCTCAGGCAAAAGGACAGAAGCTAAAAGCC
Streptococcus uberis 0140J
SUB0988 glyP -211 66.9 GACGGACTTCTGGAGAGACCTTTTTAGGCGCCGAAGGGGCAAGGCAACTGTGCTCAATCTCTCAGGCAAAAGGACAGAAGGTAACAGAT
SUB0988 glyP -291 25.4 GATACCACACAGGAGAAGAAAGTAATTTCGCCGAAGGAGTTAAACTCTCAGGTGTTCAGAAATGAACGGGACTGTTGGTGG
Streptococcus suis 05ZYH33
SSU05_0249 glyP -210 61.2 GACGGAACTCTGGAGAGACCATTTTGGCACCGAAGGGGCAAGGTAGTCCTGCTTGGAAAAGTAGAGCTACTGAAACTCTCAGGTAAAAGGACAGAGCGTTGAAAAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1084 glyP -288 23.5 GATGTCATGCAGGAGAAGAAAGTTATTTCGCCGAAGGAGTTATACTCTCAGGTGTCCACCTATTGGACGGGACTGTTTGATGG
SDEG_1084 glyP -206 68.3 GACGGACTTCTGGAGAGACCTTATTAGGCGCCGAAGGGGCAAGGCAAACTGCTCAATCTCTCAGGCAAAAGGACAGAAGATAAGATAG
Streptococcus gallolyticus UCN34
GALLO_1191 glyP -398 32.3 GATGTCATTCAGGAGAAGAAAGCTTGCCTTTCGCCGAAGGAGTTACGCTCTCAGGTGTCATAGACAGGACTGGGTGACGG
GALLO_1191 glyP -319 54.5 GACGGACTTCTGGAGAGACCTTGTTATCAAATCATTTGATAACAGCTAGAATTTCCACTAGAGTCAGTAGTGTTTTTAAGGGCTTTGTATTACTTACTGATTGCTAATTGGGTTATCTAGATTAGGCGCCGAAGGGGCAAGGTTGACCTTTGTCAACTCAAACTCTCAGGCAAAAGGACAGAAGATAAGAATG
Streptococcus mitis B6
smi_1722 glyP -180 57.7 TGGACGGAACTCTGGAGAGACCGTGAAGGCACCGAAGGGGCAAGGCAGGCAACTGCTCAAACTCTCAGGTAAAAGGACAGAGCTAGGATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD