Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HmcR in Desulfovibrionales

Properties
Regulator family: Rrf2
Regulation mode:
Biological process: Energy metabolism
Effector:
Regulog: HmcR - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfohalobium retbaense DSM 5692
Dret_0877 hmcA -158 5.1 TCGCCTACTCAGCCGGTAGGTTT
Dret_0877 hmcA -133 5.5 ATACCTACCACTGAAGTAGGATT
Desulfomicrobium baculatum DSM 4028
Dbac_0568 hmcA -194 4.6 TTCTATACCTCCGAGGTCGGAAT
Desulfovibrio desulfuricans G20
Dde_0653 hmcA -291 6 TCGCATACCTCAGCGGTAGGAAA
Dde_0653 hmcA -266 5.5 AATCATACCATGCAGGTAGGGTA
Desulfovibrio salexigens DSM 2638
Desal_1378 hmcA -176 4.5 ATACCAACCCGATGGATGGGAAA
Desal_1378 hmcA -201 4.7 AAACCTATCTATTGAGGAGGTAT
Desal_1378 hmcA -226 5.5 TAACATACCTATCGAGCAGGTAT
Desulfovibrio vulgaris Hildenborough
DVU0536 hmcA -210 5.8 TAGCATACCCCCGCAGTAGGATT
DVU0536 hmcA -185 5.5 TTCCATACTATACAGGTAGGGTA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2598 hmcA -346 6 TCGCATACCCCTCCGGTAGGAAT
DvMF_2598 hmcA -321 5.9 TTCCATACCCTAGAAGTAGGGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD