Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Streptococcaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_0488 ribU -249 52 CTTCTCTTTAAAGAAGTCCGTGAGCGCAAGCTGATGTGGTGAGATTCCACAACCGACAGTATAGTCTGGATGGGAGAAGACGAAAGA
SP_0178 ribD -249 123.7 TAACTATCTTCAGGGCAGGGTGAAATTCCCTACCGGTGGTATAGCCCACGAGCCGAAAGGCATGATTTGGTGAAATTCCAAAGCCGACAGTATAGTCTGGATGAAAGAAGATAAAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1631 ribU -175 114.8 TAAGTGTCTTCAGGGCAGGGTGTAATTCCCGACCGGCGGTGACTAGTGCAGCTAGAAGTCCGCGAGCGCAAGCTGATGTGGTGTGATTCCACAACCGACAGTAAAGTCTGGAAGAGAGAAGACCGGG
Streptococcus gordonii str. Challis substr. CH1
SGO_1664 ribU -283 111.3 AAAGAGTCTTCAGGGCAGGGTGAGATTCCCGACCGGCGGTAATTTTTGGATTGGAAATGTTTTTTTCTCAATGCCAAATCAAGTCCGCGAGCGCAAGCTGATGTGGTGAGATTCCACAACCGACAGTATAGTCTGGATGGGAGAAGACGAAG
Streptococcus thermophilus CNRZ1066
str0268 ribU -126 110.8 AGGGTCTTCGGGGCAAGGTGAAACTCCCGACCGGCGGTGATTCTTTGGATAAGTCCGCGAGCGCAAGCTGATGAGGTGTAATTCCTCAACCGACAGTATAGTCTGGATGGAAGAAGACCAGTCT
Streptococcus mutans UA159
SMU.1703c ribU -323 81.8 CTTCAGGGCAGGGTGAGATTCCCGACCGGCGGTGACAAAGGCGATGATTTTTCAACGAGATTAGATAGTAAGTCGAAGATGATATTAGACTATATCAAGATGAGCTAATGATGCGTCAGAGAAAAGATTCCTTTTGAAGTCCGCGAGCGCAAGCTGATGTGGTGAAATTCCACAACCGACAGTAAAGTCTGGATGGGAGAA
Streptococcus pyogenes M1 GAS
SPy0373 ribU -201 114.4 AGTGTCTTCAGGGCAGGGTGTGATTCCCGACCGGCGGTGACTAGTAACTAGAAGTCCGCGAGCGCAAGCTGATGTGGTGTAACTCCACAACCGACAGTATAGTCTGGATGAGAGAAGACCGGGCT
Streptococcus sanguinis SK36
SSA_1773 ribU -281 111.2 ATGATGTCTTCAGGGCAGGGTGAGATTCCCGACCGGCGGTAATTTTTGGATTGGAATTTTTTTCTCCATGTCAAATCAAGTCCGCGAGCGCAAGCTGATGTGGTGAGATTCCACAACCGACAGTATAGTCTGGATGGGAGAAGACGAGA
Streptococcus agalactiae 2603V/R
SAG1403 ribU -215 115 TAGGTGTCTTCAGGGCAGGGTGTAATTCCCGACCGGCGGTAATCGCTTCCAACTTATTTGTCAGTTGTGAAGCATCAGTCCGCGAGCGAAAGCTGATGTGGTGAGATTCCACAACCGACAGTAAAGTCTGGATGGGAGAAGACAAAG
SAG0746 ribD -307 108.7 AATTTCTTCGGGGTCAGGTGAAAATCCTAACCGGCGGTATAGTCCGCGAGCTTTCGAGCATGAACTGGTGTGATTCCAGTACCGACAGTAAAGTCTGGATGAGAGAAGAATTCAGT
Streptococcus uberis 0140J
SUB0410 ribU -201 121.2 AGTGTCTTCAGGGCAGGGTGAAATTCCCGACCGGCGGTGACTAGTCAACTAGAAGTCCGCGAGCGCAAGCTGATGTGGTGAAACTCCACAACCGACAGTAGAGTCTGGATGAGAGAAGACCGGGTT
Lactococcus lactis subsp. cremoris SK11
LACR_1395 ribU -252 100.4 AAAATATCTTCAGGGCACCGTGTAATTCGGGACCGGCGGTAAATAAGGCTTTGACCTTATGACTCCGCGATTCGCTACGGCGATTGAAGCAGTGAAACTCTGCTAGCGACAGTAAAGTCTGGATGGAAGAAGATGAAC
Lactococcus lactis subsp. lactis Il1403
L106755 ribU -252 99.8 AAAATATCTTCAGGGCACCGTGTAATTCGGGACCGGCGGTAAATAGGGCTTTGACCTTATGACTCCGCGATTCGCTACGGCGATTGAAGCAGTGAGAATCTGCTAGCGACAGTAAAGTCTGGATGGAAGAAGATGAAC
L0163 ribD -298 118.8 TAAATCTTCAGGGCAGGGTGTAATTCCCTACCGGCGGTATAGCCCGCGAGCTGCTTGCAGCATGATTCGGTGAAACTCCGAGGCCGACAGTATAGTCTGGATGAAAGAAGATAATAAA
Streptococcus suis 05ZYH33
SSU05_1696 ribU -218 76.4 TTCAAGGCAGGGTGAAATTCCCGACCGGCAGTGTAAAACGTGGTAATTTGTTTTACGACTAAGCAGCGAATCGAAGACCATACTGAATGTATGTCGAGATGAGCTAACGCAGTTTTAGAACAAAATAGACCGTTGGTAGTCTGCGAGCGAAAGCTGATGTGGTGCAATTCCACAACCGACAGTAAAGTCTGGATGGGAGA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0423 ribU -202 119.9 AGTGTCTTCAGGGCAGGGTGTGATTCCCGACCGGCGGTAACTAGGTAACTAGAAGTCCGCGAGCGCAAGCTGATGTGGTGCGATTCCACAACCGACAGTATAGTCTGGATGAGAGAAGACCGGGTT
Streptococcus gallolyticus UCN34
GALLO_0692 ribD -365 52.2 TATGTCTGCGAGGTGTCGCCTAGACTAAAAGCAAATCATCAATCAACTTTGTTTGATAATCAAATGAGCAAAGATAAGTCCGTGAGCGCAAGCTGATCTGGTGCGATTCCAGAACCGACAGTATAGTCTGGATGGGAGAAGAAATTGAT
GALLO_1792 ribU -194 47.7 ACTTAGTTAGTTTAGAAAACGAACGAGAGTGATTTAAAGTCCGCGAGCTGCAGGGCAGCTGATCTGGTGCGATTCCAGAACCGACAGTATAGTCTGGATGGGAGAAGACCAAG
Streptococcus mitis B6
smi_1807 ribU -250 52 TCCTTCTCTTTAAAGAAGTCCGCGAGCGCAAGCTGATGTGGTGAGATTCCACAACCGACAGTATAGTCTGGATGGGAGAAGACGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD