Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Lactobacillaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Oenococcus oeni PSU-1
OEOE_1680 ribU -363 117 AAATTCTTCGGGGCAGGGTGTGATTCCCAACCGACGGTAACAACATTTTGTTGAAGTCCGTGACCCGCGCAAGCGGTTGACCCAGTGAAACTCTGGGACCGACAGTATAGTCTGGATGGGAGAAGAAATAGAC
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_1295 ribU -236 98 ATAATAACTTCAGGGTCGGGTGTAAGTCCCAACCGGCGGTGAGACATGAATTTTCATGGTAAGCCCGCGACCTGCTTTTGCAGCTGATCTGGTCAAAATCCAGAGCCGACCGTAAAGTCGGGTATAAAGAAGTCTAAA
LEUM_0822 ribD -259 115.1 TTAATCTTCGGGGCAGGGTGTAATTCCCGACCGACGGTGATGGTGAATAACCTCAGTCCGTGACCCGCGATATTTTCGCGGTTGACACAGTGAAATTCTGTGACCGACAGTTAAAGTCTGGATGGGAGAAGATTTGAAA
Pediococcus pentosaceus ATCC 25745
PEPE_1593 ribU -244 94.3 GGTTCATCTTCAAGGGGCAGGGTGCGATTCCCGACCGGTGGTAAAGTCCATGAGCTGTCATTCGTGATGGCTGATTCGGTGAAATTCCGAAACCGATAGTTAAAGTCTAGATAAAGGAAGATTGAA
PEPE_1820 ribD -249 115.4 TAGATTTCTTCGGGGCAGGGTGTAATTCCCGACCGACGGTAACAACCAAGGGTTGAAGTCCGTGACCCGCGAGTAGCGGTGGACCTAGTGAGAGTCTAGGACCGACAGTATAGTCTGGATGGGAGAAGAAACGT
Lactobacillus sakei subsp. sakei 23K
LSA1023 ribU -260 101.5 GGTTCGTCTTCAGGGGCAGGGTGTAATTCCCGACCGGCGGTAAAAGTCCGCGACCTGCTGCAATGTTGATTCTTGTGGTGGCTGAACTGGTGTGATCCCAGTACCGATAGTGAAAGTCTAGATGGAAGAAGATAGGG
Lactobacillus brevis ATCC 367
LVIS_0772 ribU -233 110 TTCATCTTCAGGGCAGGGTGGAATTCCCGACCGGCGGTAAAGTCCGCGACCCGCGTGAGCGGTTGATTCGGTGTAACTCCGAAACCGACAGTAAAGTCTGGTATGCAGAAGATGAGACG
LVIS_1653 ribD -264 118.4 ATGATTTCTTCGGGGCAGGGTGAAATTCCCGACCGACGGTGACAACTTAAAGTTGAAGTCCGTGACCCACGTTTAACGTGGTTGACCCAGTGTGAGTCTGGGACCGACAGTATAGTCTGGATGGGAGAAGAAACGA
Lactobacillus casei ATCC 334
LSEI_1373 ribU -214 108.4 TTCGTCTTCAGGGCAGGGTGCAATTCCCGACCGGCGGTATAGTCCGCGACCCGCTTATGCGGTGGAACCGGTGTGACTCCGGTACCGATAGTGATAGTCTAGATGGAAGAAGATGGGGCT
Lactobacillus plantarum WCFS1
lp_1887 ribU -246 99.1 GGTTCATCTTCAGGGCAGGGTGTGATTCCCGACCGGCGGTAATAACCCGCGACCTATGCGTGTGCATAGTGATTTGGTGCAATTCCAAAGTCGACAGTAAAGTCTGGTATAAAGAAGATCGAG
Lactobacillus johnsonii NCC 533
LJ1088 ribU -193 91.8 GTTGTCTTCAGGGCAGGGCGAAATTCCCGACCGGCGGTTAGAGTCCGCGAGCTACACATGTAGTTGAACCTCAGGTACCGATAGTTATAGTCTAGATGGAAGAAGACAGACTA
Lactobacillus acidophilus NCFM
LBA0965 ribU -192 86.7 GTTGTCTTCAGGGCAGGGTGAAAATCCCGACCGGCGGTTAGAGTCCGCGACCCACGTAAGTGGTTGAATCGTTAGATACCGATGGTTATAGTCTAGATGGAAGAAGACAGACTA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0772 ribU -195 84.7 GTTGTCTTCGGGGCAGGGTGAAAATCCCGACCGGCGGTGCAAGTCCGCGAGCCACGCGAGTGGTTGAATGCTGTAAAGCTACCGATAGTTATAGTCTAGATGGGAGAAGGCAGACGT
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0937 ribU -238 98.4 TAGGTGTCTTCAGAGGCAGGGTGAAATTCCCGACCGGCGGTGAAAGTCCGAGAGCTGCTATTGTATATAGTGGTTGAACTGGTTCGATTCCAGTACCGACAGTATAGTCTGGATAAAAGAAGATGAGC
Lactobacillus fermentum IFO 3956
LAF_0875 ribU -215 91.7 TTTGTCTTCAAGGCAGGGTGTAATTCCCGACCGGCGGTATAGCCCGCAACCCGCACACGCGGTGGAACCCGGTGAAATTCCGGGTGCCGACAGTAAAGTCTGGTATGTAGAAGATCATCAC
LAF_0776 ribD -297 113.5 ATAATTTCTTCGGGGCAGGGTGAAAATCCCGACCGACGGTGACAAGCAATGCTTGAAGTCCGTGACCCGCAAATTTGCGGCTGAACCAGTGCGATTCTGGTACCGACAGTGAAAGTCTGGATGGGAGAAGAAAAGG
Lactobacillus helveticus DPC 4571
lhv_1057 ribU -193 87.1 GTTGTCTTCAAGGCAGGGTGAAAATCCCGACCGGCGGTTAGAGTCCGCGACCCACGCAAGTGGCTGAATCTTTTGATACCGATAGTTAAAGTCTAGATGGAAGAAGACAGATCG
Lactobacillus reuteri JCM 1112
LAR_0824 ribD -287 127.3 ATTTTCTTCGGGGCAGGGTGAAATTCCCAACCGACGGTAACAAGTACGCTTGGAGTCCGTGACCCGTTAGCATTTATGTTAACGGTTGAACCAGTGAAAATCTGGTACCGACAGTATAGTCTGGATGGGAGAAGAAAACTAA
Lactobacillus rhamnosus GG
LGG_01383 ribU -219 110.9 TTCGTCTTCAGGGCAGGGTGTAATTCCCGACCGGCGGTATAAAGTCCGCGACCCGCTTTTTGCGGTGGAACCGGTGTGATTCCGGTACCGATAGTGATAGTCTAGATGGAAGAAGATGGGGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD