Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE2 in Desulfovibrionales

Properties
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfohalobium retbaense DSM 5692
Dret_0525 wtpA -32 4.4 TATATGTCTTTTTTAGCAAAGG
Dret_0225 null -10 5 GTTATGTTTTATGAGGCATAAC
Dret_1807 null -166 4.6 GCTATGCAAAAAATCACATAAG
Desulfomicrobium baculatum DSM 4028
Dbac_1570 null -125 4.8 TATGTATTATTTATAACATATT
Dbac_1566 null -227 5 ATGATGCCAAACAAGGCATAAT
Dbac_2970 null -120 4.9 GTTATGTCACCCATGACATATG
Dbac_1563 null -192 5 GTTATGCCTTTCCGGGCATATT
Dbac_1563 null -63 5.4 GATATGTCAATATTGACATGTT
Dbac_2354 wtpA -76 4.4 TTTCTGTCTTTGTTGACTTAAA
Dbac_3402 null -32 4.4 CGTATGTCATTTTTCACTTAAC
Dbac_3402 null -62 5 CTTGTGTCTGATTTGGCATATG
Desulfovibrio desulfuricans G20
Dde_0234 null -65 4.4 ATTGTGTTTTATTTAGCTGATT
Dde_2460 aor-4 -196 4.6 TTTAGGTTAAAAATAACTTAAT
Dde_0715 null -177 5.4 GTTCTGCTATTATTAACATATT
Dde_3512 fdnG -133 5.2 GTTGTGTTAATATTAACACATT
Dde_0814 null -109 4.6 TTTATGCTTTTTTTAACAAAAA
Dde_3511 null -99 5.1 AATATGCTCAACAAGACATAAC
Dde_3538 null -66 4.7 AATATGCCTGCACAGGCATATG
Desulfovibrio magneticus RS-1
DMR_17150 mop -142 5.4 AATGTGTTAATAATAACATAAC
DMR_24460 null -97 5.4 CTTATGCTAATTTTAGCATAAC
DMR_02370 null -327 4.2 ATAATATTTAAAATAACATAGT
DMR_17520 nifE -312 4.8 GTTGTGTCAAAACAGACAGAAG
DMR_24460 null -113 4.8 CCTATGTTATTTTTAACTTATG
DMR_15760 null -81 4.6 CGTGTGCCTGATTAGACATAAC
DMR_15760 null -226 4.4 TTTGTATTTAAAATAACTTAAT
DMR_12510 null -30 4.1 GTTAAGTTAAATTTGACAGAGG
Desulfovibrio salexigens DSM 2638
Desal_2876 null -136 4.8 ATTGTGCTCATATTGACATAGA
Desal_2876 null -245 4.1 GATATATTTTAAACAGCATAGG
Desal_2416 wtpA -106 5 ATTATGCTCTCCATGACATATG
Desal_2878 null -78 4.1 CATATGCTTTTTTTAACAGGAA
Desal_2878 null -178 4.9 ATTATACCATTTTAGCCATAAT
Desal_2666 null -48 5.1 ATTGTGCCCTATACGGCATAAT
Desal_1641 null -169 5.3 AATATGCCAAAAAAGATATAAT
Desal_2659 null -127 5 TATGTGCTAAATCTAACATATT
Desal_0300 null -114 5.2 ATTATGTCTTTTTTGATATATC
Desal_0300 null -336 5.2 ATTATGTCATTTTGGACCTAAT
Desal_2877 null -143 4.8 TCTATGTCAATATGAGCACAAT
Desulfovibrio vulgaris Hildenborough
DVU0586 null -170 4.6 TGTGTGTTAATTGTAACATATT
DVU2812 fdnG-3 -333 4.2 TATATGTTTTATTTAACCTACT
DVU1560 null -111 4.3 GTTATGCAAGTCTGTGCATAAG
DVU2405 null -332 4.8 TCTATGTTTTTTCTGGCATATG
Desulfovibrio vulgaris str. Miyazaki F
DvMF_0320 phsA -216 5.1 CATATGTCTGAAAAAGCATAAT
DvMF_2533 null -179 4.7 ATTCTGTCAGGATAGGCATATA
DvMF_1956 null -258 4.6 CCTATGTCATGCAAGGCATAAA
DvMF_1956 null -310 4.7 AATGTGTCACCATTGACATAGT
DvMF_0650 null -143 4.3 ATTATGTCATTATGAGCAGGTA
DvMF_2780 null -227 4.5 GTTCTGTTTTTTTCAACATGTT
DvMF_0321 null -331 5.2 ATTATGCTTTTTCAGACATATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD