Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Streptococcaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus pneumoniae TIGR4
SP_1355 rplJ -175 80 ATACGGTTTAAAAAAACTGCCTAAGACAGTAGGGGAGCTCGACTCATAAATATCCTACCGAGGACAAAACGTATCATGTAAAAAGAAGCGTATTGTACTTTCGTGTCTAGGTTTGGGCGCGTTTTTCTTTTTGAAAA
Streptococcus gallolyticus UCN34
GALLO_1248 rplJ -165 78 GGTTTTGTAATGAAACTGACCTAAGACAGCAGGGGAGCCGTGCTCATAATATTCCTGCCGAGGCACAAAACGTAATGATGAAATAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGAATTTTTTTGTACCTAG
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0853 rplJ -113 76.6 GGTTTGATAAAAACTGACCTAAGACAGCAGGGGAGCGTGCTCATAATATTCCTGCCGAGGCACAAAACGTAATTAGAGAAATAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGATTTTTTGTACCTAGCCC
Streptococcus suis 05ZYH33
SSU05_0984 rplJ -126 74.5 GGAGGTTTGAAAAAACTGACCTAAGACAGTAGGGGAGCTGGACTCATAAACATCCTACCGAGGCACAAAACGATTATTGAGATAAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGATTTTTTTGTGCCTAG
Lactococcus lactis subsp. lactis Il1403
L0407 rplJ -152 81.4 ACGGTTCTAAAAGAACTGACCGAAGACAGTAGGGGACGAAAGTCATAAACTTCCTACCGAGGACAAATATCAAAATGATAATTGAACTCTCTATGTCTTTTGTGTGTAGAGATTTTTTATTTCTACA
Lactococcus lactis subsp. cremoris SK11
LACR_1387 rplJ -152 81.8 ACGGTTCTAAAAGAACTGACCGAAGACAGTAGGGGACGAAAGTCATAAACTTCCTACCGAGGACAAATATCAAAATGATAATTGAACTCTCTATGTCTTTTGTGTGTAGAGATTTTTTGTTTCTACA
Streptococcus uberis 0140J
SUB0777 rplJ -162 80.8 GTTTTGAAAAAAACTGACCTAAGACAGTAGGGGAGCAATGCTCGTAATATTCCTACCGAGGCACAAAACGTCATTAAAGAAATAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGTTTTTTTTGTACCTAACC
Streptococcus agalactiae 2603V/R
SAG1302 rplJ -164 78.5 AAGTTTCTGATGAAACTGACCTAAGACAGTAGGGGAGCAGTGCTCATAATATTCCTACCGAGGCACAAAACGTCATTATAAAATAACGTATTGTACTTTCGTGTCTAGGTTTAGGTGCGATTTTTTTGTGCTTAT
Streptococcus sanguinis SK36
SSA_1104 rplJ -172 79 ATGGTTTGAAAAAACTGCCTAAGACAGTAGGGGAGCTCGACTCATAAAGATCCTACCGAGGACAAAACGTATCATGTAAAAAGAAGCGTATTGTACTTTCGTGTCTAGGTTTGGGCGCGTTTTTCTTTTGGAAAATT
Streptococcus pyogenes M1 GAS
SPy1072 rplJ -164 81.8 TTTTGATAAAAAACTGACCTAAGACAGCAGGGGAGCATGCTCATAATATTCCTGCCGAGGCACAAAACGTGATTAAAGAAAATAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGATTTTTTTTGTACCTAGCC
Streptococcus mutans UA159
SMU.957 rplJ -162 77.6 AGGTTTTGAAAAACTGACCTAAGACAGCAGGGGAGCGTGCTCATAATATTCCTGCCGAGGCACAAAACGTAAACTGAAAAAACGTATTGTACTTTCGTGTCTGGGTTTGGGTGCGATTTTTTATTGCATTCAG
Streptococcus thermophilus CNRZ1066
str0536 rplJ -167 75 GGTTTGAAAAAAACTGACCTAAGACAGTTGGGGAGCTAGACTCGTAAACATCCAACCGAGGCACAAAACGTAACTATTTTTTTGTGACGTATTGTACTTTCGTGTCTAGGTTTAGGTACGGTTTTTTTGTGCCTAGCC
Streptococcus gordonii str. Challis substr. CH1
SGO_1192 rplJ -175 79.9 CAATGGTTTGAAAAAACTGCCTAAGACAGTAGGGGAGCTTGACTCATAAAGATCCTACCGAGGACAAAACGTATCATGTAAAAAGAAGCGTATTGTACTTTCGTGTCTAGGTTTGGGCGCGTTTTTCTTTTGGAAAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1205 rplJ -165 78.9 TGGTTTTAAATAAAACTGACCTAAGACAGCAGGGGAGCGTGCTCATAATATTCCTGCCGAGGCACAAAACGTCATTATTGAAGATAACGTATTTGTACTTTCGTGTCTAGGTTTAGGTGCGATTTTTTTGTGCCTAG
Streptococcus mitis B6
smi_0783 rplJ -173 77 ACGGTTTGAAAAAACTGCCTAAGACAGTAGGGGAGCTCGACTCATAAGTATCCTACCGAGGACAAAACGTATCATGTAAAAAGAAGCGTATTGTACTTTCGTGTCTAGGTTTGGGCGCGTTTTTCTTTTGGAAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD