Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Lactobacillaceae

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Oenococcus oeni PSU-1
OEOE_1417 rplJ -136 38.3 AAAGTAAATATCGTTTTTACCTAAGACGTCGGTTGCCGTAAGGTGTAATTCCTGCCGAGGAAAGCTAAGCTTTTTTATGGCCGCGTCTATTGCGCGGTTTTCTTATGTGTAG
Lactobacillus reuteri JCM 1112
LAR_0302 rplJ -150 75.6 GATTAAATATGACTCTGCCTAAGACTCAGGTGGCGAAAGCCTTAATCGAATGCCTGCCGAGGAAGAAATGAAAGTTCCTTCTCTATGTCTGCGGTCATAGGGATTTTTTTATAAATCCGA
Lactobacillus helveticus DPC 4571
lhv_0395 rplJ -163 71 AATAACTGTAAATTCTACCTAAGACTCGGGTGGCATGACGCCTCAAAATCCCGCCGAGGCCAGAAGATAATGAAGATTTTTATGCTCCATGTCTTTCGGCATGGAGTTTTTGGTTTAAAAGGC
Lactobacillus fermentum IFO 3956
LAF_0271 rplJ -148 68.1 GATTAAATATGACTCTGCCTAAGACTCAGGTGGCGCAAGCCTCAATACCCTGCCGAGGAAGAAATGAAATGTTCCTTCTCTATGTCTGCCAGTCATAGGGAATTTTTTATAAATTCCA
Lactobacillus salivarius subsp. salivarius UCC118
LSL_1238 rplJ -156 75.1 GGTCAAGTTAATAATTCTACCTAAGACTCAGGTGGCTAACGCCTTAAATTTATGCCTGCCGAGGAGTAAACGTATCTCTCTCTGTGTCTTGGTGTGGACATAGAGCTTTTTATTTATAAAA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_1537 rplJ -164 69.3 AGATAAAGTAAATTTCTAACCTAAGACGTGGGTGGCGTAAAGCCTCAATACAATCCCGCCGAGGCCAGAAGATAATGAAGATTGTTAAACTCTCCATGTCTTTCTTGGCATGGAGGTTTTTAGGCCTTGTA
Lactobacillus acidophilus NCFM
LBA0369 rplJ -163 70.2 GTTAATTGTAAATTCTACCTAAGACTCGGGTGGCATGACGCCTCAAAATCCCGCCGAGGCCAGAAGATAATGAAGATTTTTATGCTCCATGTCTTTCGGCATGGAGTTTTTGCTTTAAAAGGCC
Lactobacillus johnsonii NCC 533
LJ0415 rplJ -160 78.9 TTGTACAGTAAATTCTACCTAAGACTCGGGTGGCTAACGTGCCTTAATATCCCGCCGAGGCCAGAAAAACAAAGAGTTTTACAACTCCATGTCTTTTTGGCATGGAGTTTTTATTTCGGCTGATA
Lactobacillus plantarum WCFS1
lp_0621 rplJ -142 73.1 GTTAAGTAATATCTCTACCTAAGACTCAGGCGGCTTAACGGCCTTAATCTACCTGCCGAGGACATTGTTTTTTCTCTATGTCTTGGTGGACATAGGGATTTTTTTATAAATCCCT
Lactobacillus casei ATCC 334
LSEI_2273 rplJ -156 75.3 TTTGTGATCATTCACTCTGCCTAAGACTCAGGGGGCGTAAGCCTTAATTATCCTGCCGAGGTGGTATCGGAAACACTAGATACCTCTATGTCTTGGTAGACATGGAGTTTTTTTATATTTAA
Lactobacillus brevis ATCC 367
LVIS_0590 rplJ -152 76.7 AGTTATGAATTGATCTACCTAAGACTCAGGTGACCAAATTGGTCTTAATCACCGCCTGCCGAGGCAGAAGTTTACTTAAACTTTTGACTCCTTATGTCTTGGTGGCATAGGGATTTTTTTATCCCACCAA
Lactobacillus sakei subsp. sakei 23K
LSA1667 rplJ -164 79.1 TAGTTGGTTATTTATGCTACCGAAGACTCAGGTGCCAATAGGCTTAATATCCTGCCGAGGAAGATACGTTGAAATCCCTCTCTATGTCTTGGTGGACATGGAGTTTTTTATTTTATAAG
Pediococcus pentosaceus ATCC 25745
PEPE_1491 rplJ -153 60.9 ATTATAACTGAATAATTTACCTAAGACTCAGGTGGCCATGTTTGGCCTTAATATATTGCCTGCCGAGGAACGTATGAAACTATTCGTGTCTCAGAGTCTTTCTGGGGTACGAATTTTTTTATGGTTCA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0271 rplJ -145 68.4 TAATTGAATCCATTTTGCCTAAGACTCAGGTGATGCTTGCATCTTAATATCCTGCCGAGGAAGTTTAAAAAAACTTTTCCCGTGTGTCTTCTAGCGCACGGGATTTCTTTTGCAAAATAA
Lactobacillus rhamnosus GG
LGG_02277 rplJ -154 73.7 GTTGTGATTAGTCACTCTGCCTAAGACTCAGGGGGCGCAAGCCTTAATCATCCTGCCGAGGTGGTATCGGAAACAGTAGATACCTCTATGTCTTGGTAGACATGGAGTTTTTTTATTGCTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD