Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Lactobacillaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus helveticus DPC 4571
lhv_1952 null -383 79.2 AACGCGCGCTATGCTATAATGATTAATGCTAAAAAGTATAATGAACCGGAAAAAGGTGAAAAGCCTTTACAGCCCCTTCGCTACTGTAAGATTGACTGAAATGTCGCAACTCACTGGCTAAAGCCGGGAAGAAGACATTTGGGGATGAGATCAAGTCAGGAGACGCTTATTATACTAATTGCAAAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD