Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Chloroflexia

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_0305 nrtR -47 6 TTAGTGTATTACTAACACTAA
Cagg_0100 pncB -34 6.1 AAAGTGTAATAATTACACTAT
Cagg_1772 nadA -35 6.3 AAAGTGTAACAATAACACTAA
Cagg_0030 pncA -37 5.7 ATAGTGTCAGTTTTACACTAC
Cagg_1772 nadA -90 5.2 TTAGTGACCTCTTGACAATAT
Chloroflexus sp. Y-400-fl
Chy400_0205 pncB -35 5.8 TTAGTGTATAATTTACACTAT
Chy400_1521 nadA -90 5.2 TTAGTGACCTCTTGACAATAT
Chy400_1521 nadA -36 6.4 AAAGTGTAATAATAACACTAA
Chy400_4233 pncA -37 5.7 ATAGTGTCAGTTTTACACCAA
Chy400_3450 nrtR -47 6.1 TTAGTGTATAAATAACACTAA
Herpetosiphon aurantiacus ATCC 23779
Haur_3381 pncB -54 5.9 TTAGTGTATTATAGACACTAA
Haur_4290 nrtR -32 6 TTTGTGTCATAATAACACTAT
Haur_2310 nadD -35 5.2 TTGGTGTCATATTGACTATTA
Haur_1289 nadA -110 5.4 ATTGTGTTAGAATGACATTAT
Haur_1289 nadA -49 6.2 ATAGTGTCAAAATGACACTTA
Haur_2310 nadD -83 5.7 TTAGTGTGATATTGACAAAAA
Haur_1289 nadA -136 5.5 AAATTGTCATCTTGACACTAC
Roseiflexus castenholzii DSM 13941
Rcas_1635 null -39 5.8 ATAGTGTCAATATCACAATAA
Rcas_1005 nadC -65 6.2 ATAGAGTAACATTGACACTAA
Rcas_1005 nadC -11 6.6 ATAGTGTAAAAATGACACTAA
Rcas_2204 nadE -53 6.1 AAAGTGTTATACTAACACTAA
Rcas_0387 nrtR -70 5.7 TTATTGTTGTAATGACACTAA
Roseiflexus sp. RS-1
RoseRS_2679 nadE -59 5.8 AAAGTGTTATACTGACACCAA
RoseRS_0145 nrtR -34 5.5 TTATTGTTGCAATGACACTAA
RoseRS_1316 null -41 6.1 ATAGTGTCAATATAACAATAA
RoseRS_0439 nadC -11 6.6 ATAGTGTAAAAATGACACTAA
RoseRS_0439 nadC -65 6.2 ATAGAGTAACATTGACACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD