Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Various betaproteobacteria

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azoarcus sp. EbN1
ebA3086 lexA -82 5.7 ATGTGTATAAATATACAGCA
Thauera sp. MZ1T
Tmz1t_2297 lexA -37 5.9 GACTGTTTAAAATTACAGCC
Tmz1t_1948 dnaE2 -25 5.8 AACTGTATTTTTATACAGTC
Tmz1t_0548 uvrD -20 5.4 GGCTGAATATACTTACAGCC
Dechloromonas aromatica RCB
Daro_1939 lexA -44 6.1 TACTGTACAAAAATACAGTC
Daro_4152 recA -146 5.8 TACTGTATTTATACACAGTA
Daro_4062 ruvA -47 5.7 AACTGTGTGAAAATACAGTA
Daro_0473 uvrA -85 6.2 TGCTGTATAAAAAAACAGCC
Daro_2123 dinB -262 6 GGCTGTATATTTATACAGCC
Thiobacillus denitrificans
Tbd_0830 imuA -192 5.9 TACTGTATAAATCAACAGTA
Tbd_1483 lexA 125 5 TACTGTACGGACATACAGTA
Tbd_1306 uvrD -19 6.5 TACTGTATAAAAATACAGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD