Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Comamonadaceae

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_0184 Aave_0184 -33 4.8 CACTGTATTTACAATCAGTG
Aave_2670 imuA -34 5.4 TGCTGTATATTTGAACAGTA
Aave_2176 PF04055 -42 6.1 AACTGTATATTCATACAGTT
Aave_2734 imuA -43 5.7 TACTGTATAAATAATCAGTA
Aave_0516 imuA -49 5.9 TACTGTTTATTCATACAGTG
Aave_1340 parE -52 4.1 GGCTGTCTTTCCATCCAGTA
Aave_4640 recA -98 4.3 TACTGGTCAAGCATCCAGCC
Aave_2558 lexA -95 6.1 AACTGTTTAAAAATACAGTG
Acidovorax sp. JS42
Ajs_2310 lexA -54 5.8 TACTGGATTAAAAAACAGTA
Ajs_2310 lexA -73 5.5 AACTGTTCAAAAATACAGAT
Ajs_2429 PF08774 -75 4.9 TGCTGGATGAAATCACAGTA
Ajs_1965 imuA -85 4.9 TGCTGGATGAAATCACAGTA
Ajs_2803 PF04055 -23 4.9 TGCTGGATGAAATCACAGTA
Ajs_1014 parE -35 4.5 TCCTGGTTTTATATCCAGCA
Ajs_4001 recA -87 4.3 TACTGTTCAAGCATCCAGCC
Comamonas testosteroni KF-1
CtesDRAFT_1157 lexA -67 5.6 AACTGATTAAAAATACAGGT
CtesDRAFT_1157 lexA -48 5.6 TACTGGATGAACACACAGTA
CtesDRAFT_1921 imuA -35 5.6 GACTGTATATTTGTACAGTA
CtesDRAFT_1895 PF08774 -6 5.6 AGCTGTATGAAAATACAGGT
CtesDRAFT_5182 parE -52 4.4 AACTGTGAATTTATCCAGCT
CtesDRAFT_3877 recA -76 4.3 TACTGTTCAAGCATCCAGCC
Delftia acidovorans SPH-1
Daci_3565 lexA -64 4.7 TACTGTATAAATCATCAGAT
Daci_3565 lexA -83 5.8 AACTGGTTAAAAATACAGAT
Daci_5814 PF08774 -54 5.6 GACTGTATAAAGATACAGTT
Daci_4263 imuA -35 5.8 TGCTGTATATTCATACAGTA
Daci_2403 PF04055 2 5.6 GACTGTATTTTTATACAGTT
Daci_0874 recA -66 4.3 TACTGTTCAAGCATCCAGCC
Polaromonas naphthalenivorans CJ2
Pnap_1918 lexA -84 5.9 TACTGGATATTCATACAGTC
Pnap_1918 lexA -103 5.5 AGCTGTATAAAAATGCAGTT
Pnap_4894 imuA -33 6 TACTGGTTATTCATACAGTA
Pnap_1199 parE -64 5.4 AACTGTATGTTTGTACAGGT
Pnap_3956 recA -102 4.4 TACTGTTCATGCACCCAGTA
Polaromonas sp. JS666
Bpro_2954 lexA -96 5.7 TACTGGATATTAAAACAGGT
Bpro_2954 lexA -115 6.1 AACTGGATGAAAATACAGTT
Bpro_2386 imuA -56 6 TACTGTACATAAATACAGTA
Bpro_3135 PF04055 -137 5.3 AACTGGGTATTTATCCAGTA
Bpro_4982 umuD -10 5.6 TACTGGATGGATGTACAGTA
Bpro_3165 parE -114 5.3 AACTGGGTATTTATCCAGTA
Bpro_4685 recA -146 4.2 AACTGACTAAAAATAGGGTT
Bpro_0200 radA -30 5.7 TACTGGTTGTTTGTACAGTA
Rhodoferax ferrireducens DSM 15236
Rfer_2994 lexA -65 4.6 TACTGAATACAACAACAGTG
Rfer_2994 lexA -84 5.9 AACTGATTAAAAATACAGTT
Rfer_1225 imuA -48 5.3 TACTGTTGTTTTATACAGTT
Rfer_4342 umuD -10 5 TACTGTATGGATGATCAGTA
Rfer_2642 parE -38 4.2 AGCTGTGCTTTCATACAGCC
Rfer_3948 recA -38 4.3 TACTGTTCAAGCATCCAGCC
Rfer_0500 radA -31 4.9 ATCTGTTTTTCCATACAGTA
Variovorax paradoxus S110
Vapar_2636 lexA -36 4.9 TACTGGATATTCAGCCAGTG
Vapar_2636 lexA -55 5.9 AACTGGTTAAAAATACAGGT
Vapar_3206 imuA -32 6.4 TACTGTATAAAAATACAGTT
Vapar_2806 PF06733 -26 5 TACTGTTGTTTTATACAGCA
Vapar_1693 PF04055 -40 5.9 TACTGTGTAAACATACAGTA
Vapar_4538 imuA -32 5.5 TACTGTTCATCCATACAGTA
Vapar_5195 recA -83 4.3 TACTGTTCAAGCATCCAGCC
Verminephrobacter eiseniae EF01-2
Veis_4912 lexA -56 5.5 TACTGGATTGAAAAACAGTT
Veis_4912 lexA -75 5.9 AACTGGTTAAAAATACAGCT
Veis_1664 parE -52 5 AACTGTTTTTTTATCCAGCT
Veis_0355 recA -47 4.6 TACTGTTCAAGCATCCAGCT
Methylibium petroleiphilum PM1
Mpe_A0910 Aave_0184 -49 5.4 TACTGTATTTACGAACAGTA
Mpe_A1866 lexA -67 5.4 CACTGGATAAAAATTCAGTG
Mpe_A1866 lexA -86 5.8 AGCTGGATAAAAATACAGTC
Mpe_A2509 PF04055 -33 6 TACTGTACAAAAATACAGTA
Mpe_B0048 umuD -55 5.3 TACTGTATGGATGTACAGCA
Mpe_B0052 umuC -6 5.8 TACTGTATGTCCATACAGTA
Mpe_B0617 imuA -133 5.2 TACTGTATGCCCATACAGTC
Mpe_A0075 recA -54 5.3 TACTGTACAAATAACCAGTT
Mpe_A1534 imuA -44 5.7 TACTGTATTTATGTACAGTA
Leptothrix cholodnii SP-6
Lcho_2082 lexA -110 5.4 GACTGGATAAAATTACAGTG
Lcho_2079 PF04055 -39 5.1 AACTGTATGCGCATACAGTT
Lcho_0497 recA -56 4.8 CACTGTACAAACATCCAGCA
Lcho_2901 imuA -32 5.6 GACTGTATGAACATACAGTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD