Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Burkholderia

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL2495 PF04055 -67 6.3 TACTGTATGTTTATACAGTA
BPSS0003 PF10616 10 6.2 TACTGTATATTCGTACAGTA
BPSS0058 uvrA -143 5.6 AGCTGTATAAATATCCAGTA
BPSL0776 recA -108 6 CACTGTTTTTTTATACAGTG
BPSL1840 lexA -45 5.9 TACTGTATAAAAATACAGCT
BPSL1840 lexA -25 5.6 CACTGTCTATCCATACAGTC
BPSS1334 BPSS1334 -29 5.7 TACTGTATTTATGTCCAGTG
BPSL2306 dinB -28 5.9 CACTGTGTTTTTGTACAGTA
Burkholderia mallei ATCC 23344
BMA0406 PF04055 -100 6.3 TACTGTATGTTTATACAGTA
BMAA0003 PF10616 -92 6.2 TACTGTATATTCGTACAGTA
BMAA0062 uvrA -143 5.6 AGCTGTATAAATATCCAGTA
BMA1211 lexA -45 5.8 TACTGTATAAAAATACAGAT
BMA1211 lexA -25 5.6 CACTGTCTATCCATACAGTC
BMA0272 recA -108 6 CACTGTTTTTTTATACAGTG
BMAA0943 BPSS1334 22 5.1 TACTGGATAAATTAACAGTA
BMA3143 imuA -32 6.3 TACTGTATAAACGTACAGTA
BMA1727 dinB -28 5.9 CACTGTGTTTTTGTACAGTA
Burkholderia sp. 383
Bcep18194_A4180 PF04055 -46 6.4 TACTGTATAAATGTACAGTA
Bcep18194_B3181 PF10616 -91 6.2 TACTGTATGTTTGTACAGTA
Bcep18194_C7351 uvrA -144 6.2 AACTGTATGAATATACAGTA
Bcep18194_A4738 lexA -45 5.9 TACTGTATAAAAATACAGCT
Bcep18194_A4738 lexA -25 5.8 CACTGTCTATCCATACAGTT
Bcep18194_A5979 recA -121 6 CACTGTTTTTTTATACAGTG
Bcep18194_B1879 BPSS1334 -29 5.9 TACTGTATTTATGAACAGTG
Bcep18194_A6158 imuA -32 6.1 TACTGTATATCCATACAGTT
Bcep18194_A5448 dinB -28 5.9 CACTGTGTTTTTGTACAGTA
Bcep18194_B1631 PF08774 -30 5.5 ACCTGTACAAATGTACAGTG
Burkholderia cepacia AMMD
Bamb_0942 PF04055 -34 6.5 TACTGTATAAATATACAGTA
Bamb_4970 PF10616 -89 6.2 TACTGTATGTTTGTACAGTA
Bamb_6248 uvrA -57 6.2 AACTGTATGAATATACAGTA
Bamb_1496 lexA -45 5.9 TACTGTATAAAAATACAGCT
Bamb_1496 lexA -25 5.8 CACTGTCTATCCATACAGTT
Bamb_2699 recA -93 6 CACTGTTTTTTTATACAGTG
Bamb_3559 BPSS1334 -29 5.3 TACTGGATTTATGAACAGTG
Bamb_2888 imuA -32 6.1 TACTGTATATCCATACAGTT
Bamb_2179 dinB -4 5.9 CACTGTGTTTTTGTACAGTA
Bamb_3800 PF08774 -30 5.4 ACCTGTACAAACGTACAGTG
Burkholderia vietnamiensis G4
Bcep1808_0987 PF04055 -34 6.4 TACTGTATAAATGTACAGTA
Bcep1808_3790 PF10616 -89 6.2 TACTGTATGTTTGTACAGTA
Bcep1808_6497 uvrA -108 6.1 AACTGTATGAATGTACAGTA
Bcep1808_1552 lexA -45 5.9 TACTGTATAAAAATACAGCT
Bcep1808_1552 lexA -25 5.8 CACTGTCTATCCATACAGTT
Bcep1808_2763 recA -93 6 CACTGTTTTTTTATACAGTG
Bcep1808_4711 BPSS1334 -140 5 AGCTGTATAACCAACCAGTA
Bcep1808_2932 imuA -32 6.1 TACTGTATATCCATACAGTT
Bcep1808_2222 dinB -28 5.9 CACTGTGTTTTTGTACAGTA
Bcep1808_6888 imuA -36 5.7 TACTGTATATCCATACAGCT
Bcep1808_4916 PF08774 -30 5.4 ACCTGTACAAACGTACAGTG
Bcep1808_2009 imuA -34 5.7 TACTGTATATCCATACAGCT
Bcep1808_7144 imuA -39 5.9 ACCTGTATATTTATACAGTG
Burkholderia glumae BGR1
bglu_1g09000 PF04055 -67 6.2 TACTGTATAAATAAACAGTA
bglu_2g00070 PF10616 -42 6.3 CACTGTATATTTGTACAGTA
bglu_2g07270 uvrA -109 5.8 AGCTGTATGAATATACAGTA
bglu_1g18740 lexA 15 5.8 TACTGTATAAAAATACAGAT
bglu_1g29970 recA -98 6 CACTGTTTTTTTATACAGTG
bglu_2g10090 BPSS1334 -31 5.6 CACTGTATTCATAAACAGTA
bglu_1g31560 imuA -32 6.4 TACTGTATAAACATACAGTA
bglu_4p0880 imuA -166 6.1 GACTGTATATTTATACAGTA
Burkholderia xenovorans LB400
Bxe_A1003 PF04055 -54 5.9 CACTGTATATTTATACAGGT
Bxe_B3023 PF10616 -43 6.3 CACTGTATATTTGTACAGTA
Bxe_A3001 uvrA -109 6.1 ACCTGTATAAATATACAGTA
Bxe_A2471 lexA -45 6.1 TACTGTATAAAAATACAGTC
Bxe_A2471 lexA -25 5.3 ACCTGTTCATACATACAGTG
Bxe_A0671 recA -112 6 TACTGTTTTTTTATACAGTG
Bxe_A3818 BPSS1334 -44 5.7 TACTGTATAAATTAACAGTA
Bxe_A0227 imuA -32 6.2 TACTGTATATCCATACAGTA
Bxe_B1179 PF08774 -34 5.8 CACTGTATATACATACAGGT
Burkholderia phymatum STM815
Bphy_0767 PF04055 -25 6.3 CACTGTATATTTGTACAGTA
Bphy_4157 PF10616 -44 6.2 TACTGTATGTTTGTACAGTA
Bphy_1549 uvrA -73 6.3 AACTGTATAAACATACAGTA
Bphy_1630 lexA -45 5.7 TACTGTATAAAAATACAGGC
Bphy_1630 lexA -25 5.4 ACCTGTCTATCCATACAGTG
Bphy_0440 recA -121 6 TACTGTTTTTTTATACAGTG
Bphy_1972 imuA -34 6.4 TACTGTATAAATATACAGTT
Bphy_5308 PF08774 -37 5.6 GGCTGTATAAATATACAGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD