Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Oceanospirillales/Alteromonadales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_05232 recA -76 5.2 TGCTGTCAATTTATACAGTA
HCH_01222 recN -41 5.8 AACTGTATATATAGACAGTC
HCH_02202 imuA -62 5.5 TACTGATTTTATATACAGTA
HCH_02068 lexA -82 5.8 TACTGTATACATAAACAGAC
HCH_05148 yebG -42 5.5 AACTGTATGAATATACAGAG
HCH_00743 uvrD -252 5 GGCTGTAAAATTATCCAGTA
HCH_05408 PF04055 -35 6 TACTGTACATTTAAACAGTA
Marinobacter aqueolei
Maqu_2082 recA -108 5.7 TACTGTTCAAATATACAGGA
Maqu_3364 recN -62 5.8 CACTGTATGAAAAAACAGTA
Maqu_0975 imuA -34 6.5 TACTGTATATATAAACAGTA
Maqu_2332 dinB -41 5.1 GGCTGTATAAACGTACAGAT
Maqu_2007 lexA -42 5.9 CACTGTATAAAAAAACAGGA
Maqu_2961 yebG -88 6.1 TACTGTATAAATATACACTA
Maqu_3642 uvrD -20 5 GGCTGTAAATTTAACCAGTA
Maqu_1208 umuD -33 6.2 TACTGTATATTCAAACAGTA
Maqu_0977 intIA -37 5.9 TACTGTATATTTATACATAA
Marinobacter sp. ELB17
MELB17_08004 recA -142 5.3 TGCTGGTTAAATATACAGTG
MELB17_03505 recN -46 5.8 CACTGTATGAAAAAACAGTA
MELB17_15581 imuA -35 6.5 TACTGTATATATAAACAGTA
MELB17_18189 lexA -47 5.6 CACTGTATAAACAAACAGGG
MELB17_18524 dinB -98 4.7 GGCTGTATGCATATACAGCG
MELB17_11410 yebG -120 6.1 AACTGTATATATAAACAGTG
MELB17_02090 uvrD -30 5.2 ACCTGTTTATTTAACCAGTA
Oceanobacter sp. RED65
RED65_13487 recN -70 5.9 TACTGTATAAATAAACATAT
RED65_02924 dnaQ -41 6 TACTGTATATAAATACAGCT
RED65_02924 dnaQ -54 5.1 CACTTTATAAATATACTGTA
RED65_07869 recA -102 5.3 TACTGGTTAAATTTACAGTG
RED65_01690 imuA -38 6.6 TACTGTATATATATACAGTA
RED65_00670 lexA -65 5.2 TACTTTACATACATACAGCA
RED65_00670 lexA -30 5.3 CTCTGTATATAAAAACAGAT
RED65_10319 dinB -28 5.7 CACTGTATGTTAATACAGTA
RED65_05144 ruvA -51 5.3 CACTGATTAAATTTACAGTA
Oceanospirillum sp. MED92
MED92_07346 recN -28 5.3 CACTGTATAAAAACACATGT
MED92_08116 recA -61 5.7 TACTGTCCATACATACAGTA
MED92_03977 lexA -87 5.8 CACTGTATAAAAAAACATTA
MED92_03977 lexA -28 5.9 TACTGTATAAACAACCAGAA
MED92_14483 dinB -23 6.5 TACTGTATAAATAAACAGTA
MED92_05258 uvrD -34 5.2 CACTGATTATTTATACAGTG
MED92_08737 ruvC -30 5.5 GCCTGTATAAATAACCAGTA
MED92_07246 umuD -34 6.5 TACTGTATATAAATACAGTA
MED92_11029 topB -26 5.7 TACTGTTTTTATATACAGTG
Marinomonas sp. MWYL1
Mmwyl1_3966 recN -50 5.6 TACTGTATAAATAACCATAT
Mmwyl1_3732 recA -87 6 TACTGTTTTTATATACAGTA
Mmwyl1_3784 dinB -37 5.3 AACTGTGTTTTTATACAGTA
Mmwyl1_2117 lexA -44 5.8 TGCTGTATATAATAACAGTA
Mmwyl1_3691 yebG -42 6.2 AACTGTATATTTATACAGTA
Mmwyl1_2188 ruvC -43 5 GGCTGTTGAAATATACAGTA
Mmwyl1_1981 umuD -35 6 TACTGTATATCTATACAGTA
Mmwyl1_2469 umuD -34 5.6 TACTGTACGAATATACAGTC
Mmwyl1_0398 PF04055 -34 6 TACTGTTTATATATACAGCA
Mmwyl1_3275 topB -29 6.5 TACTGTATATATAAACAGTA
Mmwyl1_4249 uvrA -73 5.7 TACTGTAAAAATAGACAGTT
Saccharophagus degradans 2-40
Sde_2735 recN -43 5.2 CACTGTATAAATAACCATAC
Sde_1288 recA -163 5.2 TACTGTATAAAAAACTATTA
Sde_1030 imuA -38 5.7 TACTGTATAGACATACAGCA
Sde_1787 lexA -41 5.3 TACTGTATATTCATCCAATC
Sde_0674 yebG -46 5.3 TACTGTATACTCGTACAGCA
Sde_3764 uvrD -61 4.9 TGCTGTCTATTTATACATGT
Sde_0425 intIA -36 5.9 TACTGTATATATAAACATAT
Sde_1542 topB -30 5.3 AGCTGTATATAACAACAGTA
Teredinibacter turnerae T7901
TERTU_3298 recN -65 5.6 TACTGTATAAATAGCCAATA
TERTU_2823 recA -242 5.3 CACTGTTTACACGTACAGTA
TERTU_2925 imuA -37 6.2 TACTGTATATTAATACAGTT
TERTU_2929 dnaE2 -30 5.9 AACTGTATATTTAAACAGCA
TERTU_1938 lexA -75 6.1 TACTGTATAAACAAACAGAT
TERTU_0718 dinB -68 6 AACTGTATAATAATACAGTA
TERTU_0430 yebG -88 6 TACTGTACAAACAAACAGTA
TERTU_1758 intIA -32 5.9 TACTGTATGTACAAACAGTT
Cellvibrio japonicus Ueda107
CJA_3351 recN -49 5.8 TACTGTATAAACAGACAGAT
CJA_3708 PF04055 97 5.7 TACTGTATATGCATACAGAT
CJA_2230 recA -126 5.2 CACTGTATAAATTACTAGTA
CJA_1697 lexA -32 5.9 AACTGTATAAATACACAGAA
Chromohalobacter salexigens DSM 3043
Csal_0623 recA -90 5 TACTGGCTAGTCATACAGTA
Csal_3096 recN -52 5.7 TACTGTATAAACACACAGAG
Csal_2070 lexA -40 4.8 TACTGTATACTTGAACACGT
Csal_1500 PF04055 -34 5.6 TACTGGCTATAAATACAGTA
Reinekea sp. MED297
MED297_13572 recA -31 5 TACTGGTCATTCATACAGCA
MED297_09676 recN -82 5.8 AACTGTATATATATACATAT
MED297_04849 imuA -35 6.3 TACTGTATATACATACAGTT
MED297_16639 sulA -30 5.7 TACTGTTTATTTATACAGGC
MED297_16754 lexA -28 5.8 TACTGTATATATTAACAGGC
MED297_03315 dinB -28 5.4 AACTGTATAAGCATACAGGT
MED297_19917 uvrD -27 5.1 CCCTGTTTTTTTATACAGTT
MED297_04517 intIA -45 5.9 TACTGTATAAATATACATAT
MED297_12852 uvrA -188 5.7 GACTGTACACATATACAGTA
Alcanivorax borkumensis SK2
ABO_1801 recA -109 4.3 TACTGTCCATAACGCCAGTG
ABO_0311 Sde_0008 -40 4.3 CACTGACCATAAGAACAGTC
ABO_1009 lexA -181 4.2 CACTGTTCTTATTGTCAGTA
ABO_1583 umuD 20 5.4 TACTGTACATATAGGCAGTA
ABO_1594 PF04055 -29 5.8 TACTGTACAAAAAGACAGTA
ABO_0427 uvrA -43 4.7 CCCTGTTCATTTTGACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD