Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Psychromonadaceae/Aeromonadales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_2235 SSF52540 -26 4.5 CAGTGTTTTTAAATACAGGT
Ping_0718 ruvA -64 5.3 TACTGGATATTTACTCAGTT
Ping_0008 uvrD -28 5.5 TACTGAATAAATAAACAGGT
Ping_2220 yebG -95 5.5 TACTGTATAAAAATACATGA
Ping_2461 topB -34 5.8 TACTGTGTAAAAAAACAGTT
Ping_0108 lexA -43 4.9 CACTGTTCATGTTTACAGTT
Ping_0108 lexA -58 4.6 CCATGTATGAATATACACTG
Ping_3381 recA -55 5.2 TACTGAGTGCATATACAGTT
Ping_3381 recA -89 5.5 TACTGTGTAAATCAACAGTA
Ping_0914 recN -48 5.2 GACTGTGCAAATAAACAGTG
Ping_0914 recN -71 6.1 TACTGTTTAAAAAAACAGTA
Ping_2235 SSF52540 -41 4.8 TACTGTTGTTTTATACAGTG
Psychromonas sp. CNPT3
PCNPT3_01364 uvrD -28 5.2 TACTGATTAAATAGACAGGT
PCNPT3_05579 dinB -55 6 TACTGTATATATAATCAGTT
PCNPT3_12972 uvrA -37 5.4 TACTGTTTTAATTAACAGTG
PCNPT3_08640 topB -76 6 TACTGTCTATATAAACAGTT
PCNPT3_11040 ruvA -64 5.2 CACTGGATATAAAGTCAGTT
PCNPT3_02010 lexA -37 5.6 CACTGTCTATATTAACAGTT
PCNPT3_02010 lexA -52 4.5 CCATGTATAGATATACACTG
PCNPT3_07113 null -43 5.6 TACTGTTCATAATAACAGTA
PCNPT3_13378 recA -65 5.6 TACTGTATGAATAGTCAGTA
PCNPT3_13378 recA -45 5.4 AACTGATCATATAAACAGTA
PCNPT3_10460 recN -33 5.6 CACTGTTCATACAAACAGTA
PCNPT3_10460 recN -56 6.1 TACTGTTTAAAAAAACAGTA
PCNPT3_06983 SSF52540 -43 5.1 TACTGTTAACTTATACAGTG
PCNPT3_06468 yebG 74 5.3 TACTGTATATAAAACCATGA
PCNPT3_06983 SSF52540 -28 4 CAGTGGTTTTATTTACAGGG
Moritella sp. PE36
PE36_14089 SSF52540 -22 4.7 CACTGGATATGCAAACAGGC
PE36_14089 SSF52540 -37 5.4 TACTGTATGTATAACCACTG
PE36_19455 polB -45 4.8 TGCTGTACACTTAACCAGTC
PE36_16064 recG -35 5.4 ATATGTTTATATATACAGTA
PE36_11847 yebG -38 4.8 CACTGTCATAATATACAGTG
PE36_15844 uvrD -35 5.6 TACTGATTAAATATACAGTC
PE36_21990 dinB -50 4.8 AACTGGTCTTTTATACAGTG
PE36_16620 topB -36 5.5 AACTGTTTATTCATACAGTC
PE36_02589 ruvA -74 5.3 ATCTGGATATTTAACCAGTA
PE36_16374 lexA -30 5.9 AACTGTATATAAAACCAGTT
PE36_16374 lexA -50 5.2 TACTGTATATAATTACAAGA
PE36_11322 radA -65 5.4 AACTGTATATACATCCAGAT
PE36_23016 recA -68 5.5 TACTGTATGAACGAACAGTA
PE36_05748 recN -25 4.2 GGCTGATAAAATAAACAGGA
PE36_05748 recN -42 5.5 TACTGTATATAAAACCAGGC
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_2107 polB -52 4.8 CACTGTATGAACGTACAATA
AHA_0284 recG -35 5 ATCTGGACATATTTACAGTG
AHA_2277 yebG -53 4.7 TACTGTATATCCATACATAT
AHA_3955 uvrA -72 5.2 ACCTGTCTATTCATCCAGTA
AHA_0220 uvrD -26 5.4 GCCTGTATAAATAAACAGGA
AHA_1145 dinB -22 4.9 ACCTGTTTATTCGTACAGTG
AHA_4047 topB -34 5.8 TACTGTTCACATATACAGTA
AHA_3648 ruvA -74 5.1 TGCTGGATACTTATCCAGTT
AHA_0183 lexA -29 5.3 TGCTGTATAAAAAGACAGGT
AHA_0183 lexA -49 5.3 CACTGTATATACTGCCAGTG
AHA_3716 recA -68 5.9 TACTGTATGAATAGACAGTA
AHA_2986 recN -45 5.8 TACTGGATACATACACAGTA
AHA_2986 recN -67 5.6 TACTGTATGGAAAACCAGTA
Aeromonas salmonicida subsp. salmonicida A449
ASA_2190 polB -73 4.8 CACTGTATGAACGTACAATA
ASA_4113 recG -35 4.3 ATTTGGACATATTTACAGTG
ASA_3999 uvrA -72 5.2 ACCTGTCTATTCATCCAGTA
ASA_4174 uvrD -26 5.4 GCCTGTATAAATAAACAGGA
ASA_3190 dinB 11 5.2 AACTGTTTATTCGTACAGTG
ASA_0267 topB -36 5.5 TACTGTTCGCATATACAGTA
ASA_0735 ruvA -74 5.1 TGCTGGATACTTATCCAGTT
ASA_4206 lexA -29 5.5 TGCTGTATAAAAAAACAGGT
ASA_4206 lexA -49 5.3 CACTGTATATACTGCCAGTG
ASA_3809 recA -69 5.9 TACTGTATGAATAGACAGTA
ASA_2999 recN -45 5.5 TACTGGATGCATACACAGTA
ASA_2999 recN -67 5.6 TACTGTATGGAAAACCAGTA
Tolumonas auensis DSM 9187
Tola_0241 recG -32 5.2 ATCTGGATAAATTCACAGTA
Tola_0231 uvrA -68 5.2 TACTGGCTATTCATCCAGTG
Tola_0349 uvrD -58 4.6 TACTGTATAAAAACCCACCC
Tola_0804 dinB -25 5.5 TACTGTGTATTTGTACAGTA
Tola_2712 ruvA -63 5.2 AACTGGATGTTCATCCAGTT
Tola_0146 lexA -27 5 ATCTGTATAAAAACACAGGC
Tola_0146 lexA -47 5.6 AACTGTATATACTCACAGTT
Tola_2731 recA -64 5.9 TACTGTATGGATAAACAGTA
Tola_2260 recN -61 5.9 TACTGTATCTATATACAGTA
Tola_2260 recN -101 5.7 AACTGTTTTAATATACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD