Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Alteromonadales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_3259 recA -106 5.4 AACTGTATGGTTGTACAGTA
Patl_4247 lexA -25 4.9 AACTGTATGAAACAACAGGC
Patl_4247 lexA -46 5.5 GACTGTATATACTCACAGTT
Patl_4079 uvrD -64 5.4 AATTGTATAAAAACACAGTA
Patl_1714 recN -26 5.7 TACTGTATATTTGAACAGGT
Patl_1714 recN -45 5.1 ATATGTATATATTTACAGTT
Patl_0460 dinB -29 5.8 AACTGTTTTTAAATACAGTT
Patl_2012 Patl_2012 -28 5.5 CACTGTATAAACAAACAGGC
Patl_2012 Patl_2012 -64 4.9 GCATGTATTTTTATACAGTA
Patl_0036 imuA -31 4.1 TACAGTAAAAATATACAACC
Patl_2944 ruvB -40 5.4 CACTGTATATAAAACCACTA
Patl_0036 imuA -44 6.2 TACTGTATGAATATACAGTA
Patl_0776 topB -43 5.4 TACTGTCTTTACATACAGTC
Patl_2345 umuD -21 6.1 TACTGTATATAATAACAGTG
Patl_1244 yebG -63 5.6 AACTGTACATAAAAACAGGT
Alteromonas macleodii 'Deep ecotype'
MADE_01729 ruvC 7 4.7 TACTGGGTATAGATCCAGGT
MADE_00200 uvrD -79 5.4 GACTGTATAAATTAACAGGC
MADE_00753 dinB -76 5.3 TACTGTCTTTTTGTACAGTT
MADE_04014 lexA -44 4.8 AGGTGTATATACTTACAGGA
MADE_04014 lexA -25 5 AACTGTATGAACAGACAGGT
MADE_03079 recA -107 5.4 AACTGTATGCTTGTACAGTA
MADE_03780 yebG -65 6.1 TACTGTTTATTTATACAGTT
MADE_02270 recN -41 4.5 TACTGTATATATCATCATGT
MADE_01066 Patl_2012 -64 4.9 CACTGTATAAGAAGCCAGTA
MADE_01066 Patl_2012 -81 4.8 TACTGTATACACATACACAC
MADE_03930 dnaQ -48 5.3 GGCTGTATAAATATACACTA
MADE_00040 imuA -33 6.2 TACTGTATAAAAATACAGTT
MADE_02270 recN -60 5.7 TACTGTATATATTATCAGTT
Glaciecola sp. HTCC2999
GHTCC_010100001659 umuD -54 6.4 TACTGTATATAAATACAGTT
GHTCC_010100001659 umuD -101 6 CACTGTATAAATTAACAGTA
GHTCC_010100000340 recA -75 6 CACTGTATAATTATACAGTA
GHTCC_010100004134 uvrD -70 5.9 CACTGTATATATCAACAGTT
GHTCC_010100008871 lexA -25 5.3 AACTGTATTAATTAACAGGC
GHTCC_010100008506 recN -28 5.5 TATTGTATATTTACACAGTG
GHTCC_010100008506 recN -47 5.3 TACTGTATATATTTACACAT
GHTCC_010100008871 lexA -44 5.8 TACTGGATATACTAACAGTA
GHTCC_010100001654 yebG -73 5.6 TACTGTTAATTTATACAGTG
GHTCC_010100001654 yebG -120 6.2 AACTGTATTTATATACAGTA
GHTCC_010100005779 ruvA -69 5.3 ACTTGTATATATGTACAGTA
GHTCC_010100007177 dinB -34 5.7 TACTGGATTAATAAACAGTG
GHTCC_010100006337 Patl_2012 -28 5.2 CACTGTATAAATAAACAAGG
GHTCC_010100006337 Patl_2012 -61 5.8 GACTGTTTATTTATACAGTA
GHTCC_010100005779 ruvA -56 4.6 TACAGTATTTTAGTACACTA
Colwellia psychrerythraea 34H
CPS_0237 lexA -27 5.3 TACTGTGTAAATTTACAGGC
CPS_0080 uvrD -130 5.9 TACTGTAATAATAAACAGTA
CPS_1040 dinB -38 6 TACTGTTTTTATATACAGTT
CPS_4134 recA -68 5.5 TACTGTACGAACTTACAGTA
CPS_4298 yebG -127 5.4 AACTGTTTTTATATACAGCT
CPS_3825 recN -58 6.2 TACTGTATAAATTAACAGTT
CPS_4792 topB -71 5.3 AGCTGTACATAAAACCAGTA
CPS_3201 SSF52540 -55 5.8 TACTGTACGTTTATACAGTA
CPS_0237 lexA -48 5.5 TCCTGTATATACTACCAGTA
CPS_2116 ruvA -60 5.7 TACTGTATAAATATATAGTG
CPS_2115 ruvC -115 4.3 TACTGTATATCAGTAATGTT
CPS_2683 umuD -35 6.3 TACTGTATATAATTACAGTA
CPS_1635 umuD -35 6.1 TACTGTATTTATGTACAGTA
Alteromonadales bacterium TW-7
ATW7_04497 recA -54 5 TACTGTGGTTTCATACAGTA
ATW7_00530 umuD -21 5.8 TACTGTACACTTATACAGTA
ATW7_15466 uvrD -84 5.4 AGCTGTTCATAAAAACAGTA
ATW7_16997 lexA -47 5.7 AACTGTATATACTCACAGTT
ATW7_16997 lexA -22 5.5 TACTGTATGGAAAACCAGTT
ATW7_06613 SSF52540 -31 5.7 TACTGTATATAAACCCAGTG
ATW7_09848 yebG -71 6.4 TACTGTATATAAAAACAGTA
ATW7_06613 SSF52540 -44 5.4 TACTGTATACATGTACTGTA
ATW7_06923 recN -43 5.7 CACTGTATAAATTACCAGTT
ATW7_06923 recN -19 5.5 AACTGGATGGATAAACAGTA
ATW7_03087 ATW7_03087 -49 5.9 TACTGTACATTTAAACAGTG
ATW7_09096 dnaQ 8 6 TACTGTTTTTATATACAGTT
ATW7_10960 topB -32 5.9 TACTGTTTATATAACCAGTT
ATW7_11140 dinB -41 5.2 CACTGTATTTTTATACAGCC
Pseudoalteromonas haloplanktis TAC125
PSHAa2389 dinB -32 5.7 GGCTGTATAAATAAACAGTT
PSHAa1877 ruvC -69 5.3 TACTGGTAATTTATACAGTG
PSHAa1218 recN -43 6 CACTGTATAAATTAACAGTT
PSHAa0122 uvrD -84 5.5 AGCTGTGTATAAAAACAGTA
PSHAa2873 lexA -91 5.5 TACTGTATGGAAAACCAGTT
PSHAa1159 SSF52540 -32 5.6 TACTGTATAAAAACCCAGTG
PSHAa0834 yebG -70 6.1 TACTGTACATAAAAACAGTA
PSHAa0694 recA -53 5.2 TACTGTGATTTCATACAGTA
PSHAa1218 recN -19 5.3 GACTGGATGGATAAACAGTA
PSHAa1996 dnaQ 8 5.4 TACTGTTTTTATATACAGCC
PSHAb0389 ATW7_03087 -49 6.3 AACTGTATATATAAACAGTG
PSHAa2356 topB -94 4.1 AACTAGAGATATATAAAGTT
PSHAa1159 SSF52540 -45 4.9 TACTGTATATGGGTACTGTA
PSHAa2873 lexA -116 5.7 AACTGTATATACTCACAGTT
PSHAb0537 umuD -41 5.8 TACTGTATACTTGTACAGTA
Pseudoalteromonas tunicata D2
PTD2_22617 ruvC -66 5.2 CACTGGTAATTTATACAGTT
PTD2_17880 umuD -21 6 TACTGTATATAACTACAGTA
PTD2_16946 lexA -45 5.5 AGCTGTATATAATCACAGTA
PTD2_13014 recA -55 5.5 TACTGTTAATCTATACAGTA
PTD2_09564 uvrD -84 5.4 ACCTGTTCATAAAAACAGTA
PTD2_18455 SSF52540 -28 5.7 CACTGTATAAACAACCAGTA
PTD2_12644 dinB -52 6.1 TACTGTATAAAAAAACAGTG
PTD2_10739 recN -43 6.2 TACTGTATAAATTAACAGTT
PTD2_09304 topB -33 5.2 CACTGTTAATCTATACAGTT
PTD2_15577 yebG -85 6.3 TACTGTATATAAAAACAGTG
PTD2_02786 ATW7_03087 -38 6 CACTGTATATAAAAACAGTG
PTD2_10739 recN -19 5.5 AACTGGATGGATAAACAGTA
Idiomarina baltica OS145
OS145_02170 lexA -47 5.4 ACCTGTATATACTCACAGTA
OS145_09368 uvrD -66 5.1 AACTGGTTGCTTATACAGTA
OS145_07237 recA -57 5.7 TACTGTGAATTTATACAGTA
OS145_12305 recN -52 5.8 TACTGTATAGGTAAACAGTA
OS145_09460 imuA -36 6.3 TACTGTACATATATACAGTA
OS145_02170 lexA -27 5.6 TACTGTACAGATAAACAGGT
Idiomarina loihiensis L2TR
IL0262 lexA -46 5.4 ACCTGTATATACTCACAGTA
IL0742 recA -59 5.5 TACTGTAAATGTGTACAGTA
IL0742 recA -39 5.7 TACTGTTTATAAAACCAGTG
IL2551 uvrD -83 5.1 TACTGGTTGCTTATACAGTG
IL0989 recN -34 5.6 ACCTGTATATATCAACAGTA
IL2568 imuA -32 6.3 TACTGTATATATGTACAGTA
IL1548 yebG -48 6.1 TACTGTACAAATAAACAGTA
IL0262 lexA -25 5.5 CACTGTACAAATAAACAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD