Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Pasteurellales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0749 lexA -46 5.2 ATCTGTATACAATACCAGTT
HI1546 impA -88 4.9 CCCTGTATGAAATATCAGTA
HI1546 impA -62 4.9 AACTGTACAAAAAAACAAGG
HI0600 recA -60 5.1 ACCTGTACATCAATACAGAT
HI0749 lexA -26 5 ATCTGTGTTTAAAAACAGGA
HI1188 uvrD -32 5.5 AACTGTAAATTTAAACAGAT
HI0250 ssb -93 5.1 ATCTGTGCAAATATCCAGTT
HI1258 mfd -96 5.6 AACTGTTTTTTTAAACAGTT
HI0249 uvrA -80 5.2 AACTGGATATTTGCACAGAT
HI0313 ruvA -64 4.7 AACTGGATGTTCGTCCAGTT
HI0070 recN -55 5.1 TACTGTAAATTAAGTCAGTT
Aggregatibacter aphrophilus NJ8700
NT05HA_0999 impA -37 5.6 CACTGTACAAAAACACAGTT
NT05HA_0999 impA -63 5.7 TACTGTATATAACAACAGTA
NT05HA_1941 recA -67 6.1 TACTGTATATTAATACAGTT
NT05HA_1581 lexA -28 4.9 TCATGTATATATTAACAGGA
NT05HA_1581 lexA -50 5.2 TTCTGTATATAATACCAGTC
NT05HA_2208 uvrA -79 5.4 AACTGGATATTTGCACAGTT
NT05HA_2209 ssb -110 5.4 AACTGTGCAAATATCCAGTT
NT05HA_0196 mfd -86 4.8 CACTGTTTTTTTATACAGAC
NT05HA_1086 uvrD -36 5.3 GCCTGTACAAAAAAACAGTA
NT05HA_1353 ruvA -66 5.6 AACTGGATATTTATCCAGTT
NT05HA_1273 recN -55 6.1 TACTGTATATTAAAACAGTA
Pasteurella multocida subsp. multocida str. Pm70
PM0892 impA -38 5.8 ACCTGTATAAATAACCAGTT
PM1817 recA -66 5.6 TACTGTTTATTCATACAGTT
PM0892 impA -64 5.5 ACCTGTATATAACAACAGTA
PM0411 uvrD -142 6.2 TACTGTATAAAAAAACAGTT
PM1181 lexA -47 5.8 TTCTGTATATAATAACAGTT
PM1950 ssb -112 5.4 AACTGTGCAAATATCCAGTT
PM1951 uvrA -79 5.4 AACTGGATATTTGCACAGTT
PM1041 mfd -101 4.4 TACTGGCTTTTTATACAGAC
PM1181 lexA -26 5.3 TTCTGTATAAAAAAACAGGG
PM0977 ruvA -65 5 AACTGGATGTTCATCCAGTT
PM0332 recN -56 6.2 TACTGTATATAAAAACAGTT
Mannheimia succiniciproducens MBEL55E
MS2243 recA -69 5.8 TACTGTATATTATACCAGTT
MS0831 impA -66 5.2 ATCTGTTTGTTTATACAGTA
MS0831 impA -40 5.7 ACCTGTATAAACAAACAGTT
MS0744 lexA -11 4.6 TCCTGTATATAATGTCAGCA
MS0586 uvrA -79 5.6 AACTGGATATTTTCACAGTT
MS0585 ssb -92 5.2 AACTGTGAAAATATCCAGTT
MS1368 uvrD -31 5.1 CCCTGTAAAAATAAACAGAT
MS0741 recN -54 5.5 TACTGTATAAAAAAACATAA
MS0744 lexA 9 5.1 TTCTGTACAAAAAAACAGGG
MS0712 ruvA -65 5 AACTGGTTATCTATCCAGTT
Actinobacillus succinogenes 130Z
Asuc_0261 recA -63 5.2 TACTGTGTTTTATACCAGTT
Asuc_0946 impA -54 4.4 AACTGTAAATTAAATCACAC
Asuc_0946 impA -80 5.1 CCCTGTTTAAGAAAACAGTA
Asuc_1880 ssb -94 4.6 ATCTGTTAAAATATTCAGTG
Asuc_1268 uvrD -30 4.8 TAGTGTAAATTTAAACAGAT
Asuc_0877 lexA -46 4.4 AACTGTATAGAATATCAATC
Asuc_1800 ruvA -60 4.1 AGCTGTTGTTTTATTCAGTT
Asuc_0884 recN -34 4.2 TATAATATATTTATACAGTA
Asuc_1879 uvrA -77 5.1 CACTGAATATTTTAACAGAT
Haemophilus somnus 2336
HSM_1015 impA -77 5.5 ATATGTATATAAAAACAGTA
HSM_0315 recA -66 5.2 CACTGTATGTGAATACAGTA
HSM_1015 impA -51 5.7 ACCTGTATAAATAATCAGTT
HSM_1774 uvrD -31 6 AACTGTATAAAAACACAGTT
HSM_1049 uvrA -97 5.4 AACTGGATATTTGCACAGTT
HSM_1048 null -101 5.4 AACTGTGCAAATATCCAGTT
HSM_0991 recN -57 5.6 TACTGTATATAAAAACATAT
HSM_0711 lexA -26 5.4 TTCTGTATATAAAAACAGGG
HSM_0991 recN -33 5.2 AATTGTATTTATATACAGTA
HSM_0711 lexA -47 4.9 TTCTGTATATAATATCATAT
HSM_0142 ruvA -65 5.6 AACTGGATATTTATCCAGTT
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_1202 recA -86 5.3 AACTGTATAAGTAAACACTA
APP7_0025 recN -61 5.6 TACTGTTCAAAAAAACAGTA
APP7_0940 radA 44 4.9 AGCTGTTTATTTACTCAGTA
APP7_1165 lexA -49 5.3 TACTGTATATAATAACAAAA
APP7_1377 uvrD -38 5.1 AACTGTATAAACGAACATTA
APP7_0845 null -99 5.4 AACTGTACAAAATATCAGTT
APP7_0382 impA -61 5.1 CACTGTTTTTTTAATCAGTA
APP7_1165 lexA -28 5 ATCTGTATATAAAGACAGCG
APP7_0382 impA -36 5.5 ACCTGTATAAACACACAGTT
APP7_0382 impA -101 4.9 TACTGGATATTTTTACAAAA
Haemophilus ducreyi 35000HP
HD0815 recN -42 5 TACTATATATCTATACAGAA
HD0410 recA -84 5.3 AACTGTATAAGTAAACACTA
HD1063 impA -61 5.2 TACTGTTTTTTTAATCAGTA
HD0545 lexA -28 5.5 TTCTGTATATAAAGACAGTG
HD0545 lexA -50 5.3 TACTGTATATAATAACACAA
HD1758 ruvA -106 5 GCCTGTTTTTTTATACAGTT
HD1121 radA -65 4.6 GCCTGTGTATTTAGTCAGTA
HD1285 ssb -96 4.9 AGCTGTACAAAATATCAGTT
HD0815 recN -63 5.8 TACTGTTTAAAAAAACAGTA
HD1032 uvrD -39 4.8 CACTGTATAAATGCACATTG
HD1063 impA -36 4.8 GCCTGTATAAATAACCATAT
HD1063 impA -100 5.2 TACTGTATATTTTTACAAAA
Haemophilus parasuis SH0165
HAPS_1355 recN -61 5.7 TACTGTGTATAAAAACAGTG
HAPS_1355 recN -40 4.6 TACTATATACTCATACAGTG
HAPS_1186 recA -84 5.3 AACTGTATGGTTAAACAGTA
HAPS_0014 lexA -28 5.5 TTCTGTATATAAAGACAGTG
HAPS_1067 uvrD -30 4.9 CACTGTATAAAATCACATAA
HAPS_0014 lexA -50 4.7 TACTGTATATAATGTCATAA
HAPS_2014 radA -67 4.9 CCCTGTGCATTTACACAGTG
HAPS_0372 ssb -191 5.4 AACTGTACAAAATATCAGTT
HAPS_2271 impA -62 5.3 CACTGTGTGTTTAAACAGTA
HAPS_2271 impA -38 5.5 AACTGTATAAACACACAGAT
HAPS_2271 impA -102 4.7 ACCTGTAAAAATTTACACTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD