Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Vibrionales

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC0852 recN -26 4.7 TATTGGTTAATCATACAGGT
VC0668 mutH -174 4.1 TACTGTTTATTGATCCATAC
VCA0291 intIA -40 5.9 TACTGTACAAATAACCAGTT
VC1368 VC1368 -60 5.8 AACTGTATTAAAAAACAGTA
VC1191 VC1191 -39 5.8 TACTGTATTTACATACAGCA
VC2711 recG -65 5 TCCTGTACAAAAACACAGCT
VC1368 VC1368 -10 4.7 TGCTGTAATTATGTACAGTG
VC2287 dinB -30 5.8 TACTGTTTATGTATACAGTA
VC0082 rmuC -56 5.5 AACTGGACATTTATCCAGTG
VC1846 ruvA -71 5.2 TACTGGCTATCCATCCAGTT
VC0394 uvrA -85 5.7 AACTGTTTTTTTATCCAGTA
VC0190 uvrD -28 5.1 TTATGTATAAATAACCAGTG
VC2326 yebG -49 5.9 AACTGTATAAACAGCCAGTT
VC0092 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VC0092 lexA -45 5 CACTGGATATACTCACAGTC
VC0543 recA 69 5.4 CACTGTACAAATCAACAGTA
VC2043 topB -84 5.5 TACTGGTTAAATTTACAGTT
VC0852 recN -66 6 TACTGTATAAAGAAACAGTA
VC0852 recN -44 6 AACTGTTTAAACATACAGTA
VC1463 rstA -89 4 GGCTGTTTTTTTGTACATTA
VC1454 null -89 4 GGCTGTTTTTTTGTACATTA
Vibrio vulnificus CMCP6
VV1_3092 uvrB -48 5.3 GAGTGTATATTTATACAGTT
VV1_0521 mutH -163 4.6 TACTGTTTATTGATCCATGA
VV1_2401 intIA -75 4.3 GGCTGTATATATACACATAT
VV1_2987 imuA -28 5.8 TACTGTATGTATATACAGGT
VV1_2297 VC1368 -39 5.4 TACTGAGTATACATACAGTT
VV1_2297 VC1368 -88 5.5 GACTGTATAAATGAACAGTA
VV1_2796 VC1191 -39 5.6 TACTGTATACACATACAGCA
VV1_0854 recG -65 4.7 TCCTGTACAAAAACACAGCC
VV1_0390 umuD -29 5.9 AACTGTATATATGTACAGTT
VV1_1830 dinB -37 5.1 TACTGTGTTTTTGTCCAGTT
VV1_1591 recA -104 5.4 CACTGTACAAATCAACAGTA
VV1_0910 rmuC -67 5.7 AACTGGACATTTATCCAGTA
VV1_1166 lexA -45 5.4 TACTGGATATACTCACAGTT
VV1_2159 ruvA -63 5.4 AACTGGATGTCTATCCAGTT
VV1_1427 uvrA -88 5.7 AACTGTTTTTTTATCCAGTA
VV1_0949 uvrD -30 5.8 TTCTGTATAAATAACCAGTA
VV1_1166 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VV1_1791 yebG -54 5.6 AGCTGTATAAACACACAGTA
VV1_3130 topB -87 5.8 AACTGTCTATACATACAGTT
VV1_0367 recN -46 5.7 TACTGAATTTATATACAGTA
VV1_0367 recN -68 6 TACTGTATAAAGAAACAGTA
Vibrio harveyi ATCC BAA-1116
VIBHAR_00966 mutH -162 4.6 CCCTGTTTATTCATCCAGCC
VIBHAR_00956 xerD -32 5.3 TACTGTAAATATAAACAGAT
VIBHAR_02961 uvrB -46 4.8 AGGTGTATATATATACAGCC
VIBHAR_02003 intIA -30 5.7 AACTGTATAAACAACCAGTC
VIBHAR_02866 imuA -29 5.6 TACTGTAAATATATACAGGT
VIBHAR_02055 VC1191 -105 5.6 TACTGTATACACATACAGCA
VIBHAR_00625 recG -65 5 TCCTGTACAAAAACACAGCT
VIBHAR_p08270 umuD -26 6.3 TACTGTATATATAAACAGTA
VIBHAR_02527 VC1368 -39 6 TACTGTATATGTATACAGTA
VIBHAR_02827 recX -83 5 AGCTGTGTAAATAATCAGTA
VIBHAR_06801 recX -83 5 AGCTGTGTAAATAATCAGTA
VIBHAR_03513 recA -89 5.4 CACTGTATGAATCAACAGTA
VIBHAR_00561 rmuC -67 5.5 AACTGGACATTTATCCAGTG
VIBHAR_01600 ruvA -6 5.1 GACTGGATGTCTATCCAGTT
VIBHAR_03708 uvrA -86 5.3 TACTGTTTTTTTGTCCAGTA
VIBHAR_00351 uvrD -29 5.4 TTATGTATAAATAACCAGTA
VIBHAR_03306 yebG -53 5.8 AACTGTATAAAAAGCCAGTA
VIBHAR_00268 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VIBHAR_00268 lexA -45 5.4 TACTGGATATACTCACAGTT
VIBHAR_03041 topB -84 5.1 TACTGTTTACCTGTACAGTT
VIBHAR_01130 recN -46 5.5 TACTGTTTTCTTATACAGTA
VIBHAR_01130 recN -68 6 TACTGTATAAAGAAACAGTA
Vibrio parahaemolyticus RIMD 2210633
VP0518 mutH -162 4.6 CCCTGTTTATTCATCCAGCC
VP2100 uvrB -74 5 AGGTGTATATATATACAGCG
VP1865 intIA -30 5.1 ACCTGTATAAATAAACAGAC
VP2034 imuA -29 5.9 TACTGTATTTATATACAGGT
VP1264 VC1191 -39 5.6 TACTGTATACACATACAGCA
VP0157 recG -65 5 TCCTGTACAAAAACACAGCT
VP1428 VC1368 -39 6 TACTGTTTTTATATACAGTA
VP2342 dinB -31 5.6 TACTGTATTTTTAACCAGTG
VP2550 recA -110 5.4 CACTGTATGAATCAACAGTA
VP0094 rmuC -67 5.5 AACTGGACATTTATCCAGTG
VP1051 ruvA -63 5.1 GACTGGATGTCTATCCAGTT
VP2712 uvrA -85 5.3 TACTGTTTTTTTGTCCAGTA
VP3013 uvrD -27 5.4 TTATGTATAAATAACCAGTA
VP2379 yebG -47 5.8 AACTGTATAAAAAGCCAGTA
VP2946 VP2946 -41 5.2 ACCTGTCTTTTTATACAGTT
VP2946 VP2946 -21 5.2 AACTGTGAGTATATCCAGTA
VP2945 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VP2945 lexA -45 5.4 TACTGGATATACTCACAGTT
VP2149 topB -85 5.7 TACTGTTCATTTATACAGTT
VP0648 recN -46 5.4 TACTGTTCTCATATACAGTA
VP0648 recN -68 6 TACTGTATAAAGAAACAGTA
Vibrio shilonii AK1
VSAK1_11158 mutH -177 4.9 CACTGATTATTCATACAGCA
VSAK1_06160 VC1191 -204 5.1 TACAGTATTCTTATACAGTA
VSAK1_11208 xerD -21 5.2 TACTGTATAAACATCCAAGA
VSAK1_25360 intIA -32 5.4 AACTGTACACAAACACAGTA
VSAK1_06160 VC1191 -39 5.6 TACTGTATACACATACAGCA
VSAK1_26830 imuA -27 5.9 TACTGTACATATATACAGGT
VSAK1_25105 VC1368 -37 5.3 TACTGGTTGTACATACAGCA
VSAK1_25105 VC1368 -65 5.6 TACTGGATATTCATACAGCA
VSAK1_09763 recG -64 5.7 AACTGTACAAAAAGACAGTA
VSAK1_12155 dinB -24 6.2 AACTGTATAAATAAACAGTT
VSAK1_13165 rmuC -170 5.3 ATCTGGACATTTATCCAGTA
VSAK1_02059 recA -131 5.4 CACTGTATGAATCAACAGTA
VSAK1_12472 lexA -25 5.7 AACTGTATAAACAGACAGGT
VSAK1_12472 lexA -45 5.4 TACTGGATATACTCACAGTT
VSAK1_00385 ruvA -66 5.4 AACTGGATACCTATCCAGTT
VSAK1_08166 uvrA -84 5.3 ACCTGTTTTTTTATCCAGTA
VSAK1_24239 uvrD -30 5.3 ATATGTATAAATAACCAGTA
VSAK1_08581 yebG -57 5.6 ATCTGTATAAACAGACAGTA
VSAK1_03504 topB -90 5.5 AACTGGCTATTTATACAGTT
VSAK1_11915 recN -28 4.9 TAATGTTCATTTAAACAGGT
VSAK1_11915 recN -68 6 TACTGTATAAAGAAACAGTA
VSAK1_11915 recN -46 5.6 TACTGAATTTACATACAGTA
Vibrio splendidus LGP32
VS_0522 mutH -115 4.9 CCCTGTTTATTTATCCACTA
VS_0980 uvrB -35 5 ACCTGATTAAAAAAACAGTA
VS_1890 intIA -29 5.2 TCATGTACATATAACCAGTT
VS_1042 imuA -28 6.1 TACTGTATAAATATACAGGT
VS_0158 recG -52 5.2 GCCTGTACAAAAATCCAGTA
VS_0702 dinB -41 5.9 TACTGTTTATAAATACAGTT
VS_0097 rmuC -68 5.7 AACTGGACATTTATCCAGTA
VS_2596 recA -94 5.4 CACTGTATGAATCAACAGTA
VS_1107 ruvA -67 5.6 AACTGGATAAGTATCCAGTT
VS_0320 uvrA -84 5.7 TACTGTTTTTTTATCCAGTA
VS_3084 uvrD -33 5.2 TTATGTATAAATACCCAGTA
VS_0670 yebG -48 5.6 AACTGTATAAAAAGCCAGTG
VS_1206 VC1191 78 5.6 TACTGTATACACATACAGCA
VS_3006 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VS_3006 lexA -45 5.2 TACTGGATATACTCACAGTC
VS_0940 topB -85 6 AACTGTATAAACAACCAGTT
VS_0646 recN -46 5.2 TACTGGGCTTATATACAGTG
VS_0646 recN -68 6 TACTGTATAAAGAAACAGTA
Vibrio fischeri ES114
VF_0455 mutH -140 4.9 CACTGTATATGGATCCAGAA
VF_1493 VC1191 -43 5.4 TACTGTATAAATACACACTG
VF_0448 xerD -51 5 TACTGTAATTCTAACCAGTG
VF_1269 umuD -27 5.2 CGCTGTACTTATATACAGTG
VF_0734 dinB -27 5.6 AACTGTGTTTTTATACAGTT
VF_0044 rmuC -62 5.7 AACTGGACATTTATCCAGTA
VF_2442 lexA -25 5.7 AACTGTATAAACAGACAGGT
VF_2442 lexA -45 5.1 AGCTGTATATACTCACAGTG
VF_0951 ruvA -66 5.8 TACTGGATATCTATCCAGTT
VF_0341 uvrA -90 5.5 CACTGTTTTTTTATCCAGTA
VF_0068 uvrD -27 5.2 ACATGTATAAATAACCAGTG
VF_0577 yebG -41 5.5 TACTGTATAAAACACCAGTT
VF_1641 topB -29 5.3 AACTGTCTATTCATACAGGT
VF_0535 recA -69 5.7 CACTGTACAAATAGACAGTA
VF_1998 recN -54 5.3 TACTGTGTCTATATACAGTG
VF_1998 recN -76 6 TACTGTATAAAGAAACAGTA
Vibrio salmonicida LFI1238
VSAL_I0568 mutH -137 5.4 CACTGTATATAGATCCAGAA
VSAL_I1693 VC1191 -21 5.4 TACTGTATAAATACACACTG
VSAL_I0562 xerD -45 5.2 TACTGTAATTCTAACCAGTA
VSAL_I0965 dinB -132 5.8 GACTGTATATTTAAACAGTT
VSAL_I0957 dinB -68 5.8 AACTGTGTATTTATACAGTT
VSAL_I2995 rmuC -62 5.7 AACTGGACATTTATCCAGTA
VSAL_I0634 recA -69 5.7 CACTGTATGAATAGACAGTA
VSAL_I2893 lexA -25 5.5 CACTGTATAAACAGACAGGT
VSAL_I2893 lexA -45 5.3 AGCTGTATATACTCACAGTT
VSAL_I1888 ruvA -66 5.8 TACTGGATATCTATCCAGTT
VSAL_I0447 uvrA -88 5.7 TACTGTTTTTTTATCCAGTA
VSAL_I0222 uvrD -27 5.2 ACATGTATAAATAACCAGTG
VSAL_I0676 yebG -41 5.5 TACTGTATAAAACACCAGTT
VSAL_I2155 topB -57 4.9 AACTGTCTATTCGTACAGGT
VSAL_I2475 recN -47 6 TACTGTATAAAGAAACAGTA
VSAL_I2475 recN -25 5.5 TACTGTTTCTTTATACAGTA
Vibrio angustum S14
VAS14_07584 mutH -165 5 GCCTGTCTATTTAAACAGTT
VAS14_07634 xerD -55 4.5 TACTGTGTTTTTATCCATGT
VAS14_12359 umuD -10 5.9 AACTGTATAAATGTACAGTT
VAS14_16776 dinB -30 5.7 AGCTGTATGTATAAACAGTA
VAS14_20496 recA -78 5.7 CACTGTATGAATAGACAGTA
VAS14_22754 rmuC -73 5.3 AGCTGGACATTTATCCAGTA
VAS14_21837 lexA -25 5.6 AACTGTATAAAAAGACAGGT
VAS14_21837 lexA -45 5.1 CACTGGATATACTCACAGTG
VAS14_18066 ruvA -66 5.4 AACTGGATGTCTATCCAGTT
VAS14_19446 uvrA -87 5 TACTGTGTTTTTACTCAGTA
VAS14_22899 uvrD -27 5.4 CATTGTATAAATAACCAGTA
VAS14_20761 yebG -44 6 TACTGTATAAACAGCCAGTA
VAS14_05738 topB -86 5.6 AACTGGTTTTATATCCAGTA
VAS14_07144 recN -42 5.5 TACTGTATGTAAAAACAGGT
VAS14_07144 recN -64 5.2 TACTGGTTATGGATACAGTA
Photobacterium profundum SS9
PBPRA0694 recN -64 5.6 TACTGTACGTAGATACAGTA
PBPRA0566 xerD -78 4.4 TACTGTGTTTATATCCATGC
PBPRB0973 umuD -4 5.4 AACTGTGCATACATACAGTG
PBPRA0832 dinB -64 6.1 TACTGTATATAAAAACAGTT
PBPRA0165 lexA -65 5.3 GACTGTATAAACAAACAGGG
PBPRA0165 lexA -85 5.3 CACTGGATATACTCACAGTA
PBPRA3068 recA -64 5.7 CACTGTATGAATAGACAGTA
PBPRA1116 ruvA -65 5 TGCTGGATATCCATCCAGCA
PBPRA3290 uvrA -91 5.4 TACTGTATCTTTATACAGCA
PBPRA3513 uvrD -27 5.4 CATTGTATAAATAACCAGTA
PBPRA3003 yebG -38 5.5 TACTGTATAAGCAGCCAGTA
PBPRA2590 topB -88 5.2 AACTGTTGTTATATCCAGTA
PBPRA0115 rmuC -68 5.4 TGCTGGACATTTATCCAGTA
PBPRA0694 recN -42 5.4 TACTGTATGAAAACACAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD