Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraR in Lactobacillaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_1743 araE -212 4.4 AAATTAATCCGAATAACAAA
LVIS_1743 araE -183 6.1 TGATTTATGCGTACAAATAT
Lactobacillus fermentum IFO 3956
LAF_1558 araK -77 5.9 TGATTTATACGGACAAAAAA
LAF_1555 araE -153 4.4 ATATTGTTCAGTATAATTTA
LAF_1554 araA -105 5.9 TGAATTGTACGGACAAATAT
Lactobacillus plantarum WCFS1
lp_3557 araE -166 6.5 TGATTTATACGTATAAATAT
lp_3558 araR -234 5.2 TTATTGATGCGGATAAATTG
lp_3557 araE -195 4.7 TAATTTGTGCTGATAAAACA
Lactobacillus reuteri JCM 1112
LAR_0467 araE -103 6.4 TGATTTATCCGTACAAATAT
Lactobacillus sakei subsp. sakei 23K
LSA1860 araE -250 5.7 ATAATTATTCGAATAAATAA
LSA1860 araE -150 4.6 ATATTGATTCGAATCAAAAA
LSA1860 araE -121 4.7 TGATTTATTCGAATGAAAGT
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0852 araA -136 5.7 TGACTTATACGGACAAATGT
Oenococcus oeni PSU-1
OEOE_0227 araK -149 5 TGATTTATATGTACGAATGT
OEOE_0227 araK -179 5 AAATTCATACGTAAAACTAA
OEOE_0227 araK -192 4.5 TTATTTTTACAAAAAATTCA
Pediococcus pentosaceus ATCC 25745
PEPE_0162 araE -121 4.5 AAATTCATCCTAACAAATTT
PEPE_0162 araE -89 6.1 TGACTTGTCCGTATAAATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD