Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Leu_leader in Enterobacteriales

Properties
Regulator family: RF00512
Regulation mode:
Biological process: Branched-chain amino acid biosynthesis
Effector:
Regulog: Leu_leader - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0074 leuA -194 138.5 TCTGGAGCTGATTTAATGACTCACATCGTTCGCTTTATCGGTCTACTACTACTAAACGCATCTTCTTTGCGCGGTAGACGAGTGAGCGGCATCCAGCATTAAGCCAGCACGCAGTCAAACAAAAAACCCGCGCCATTGCGCGGGTTTTTTT
Salmonella typhimurium LT2
STM0113 leuA -189 141.6 GCTGGAGCTGAATTAATGTCACATATCGTTCGTTTCACTGGGCTACTACTACTCAACGCATTTATTGTGCGCGGTAGACCGGTGGGCGGCATTCAACATTAAGTCAGCTCGAAGTCAAACAAAACCCGCGCCGTTGCGCGGGTTTTTTT
Citrobacter koseri ATCC BAA-895
CKO_03304 leuA -190 136.4 TGGAGTTGATTTAATGATTCGTATCGCTCGCTTTAACGGTCTACTACTACTAAACGCATCTTCGTTGCGCGGTAGACTGGTGAGCGACATTCAGCATTAAGTCAGCATCAGTAAGATTAAAAACCCGCGCCGTTGCGCGGGTTTTTTTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_00080 leuA -198 87.5 TCTGGAGTTTGACGCAATGATTCGCACCGCTCGTATCACCAGCCTACTACTACTAAACGCATGCCATTTGCGCGGTAGGCTGTTGGGCGACGTTCAGCGTTAAGTCATCTTCCAGCAAGACTATAAAACCCGCGCCTTGGCGCGGGTTTTTTT
Enterobacter sp. 638
Ent638_0622 leuA -192 130.3 TCTGGAGCATGATTCATGATTCGTACCGTTCGTTCTCTCAGCCTACTACTACTAAACGCATCTCTTTTGCGCGGTAGGCTGGCGAACGAAATTCAACGTTGAATCGTCTCCAGTAAACAAGAAACCCGCGCCATTGCGCGGGTTTTTTT
Erwinia amylovora ATCC 49946
EAM_0683 leuA -193 92.4 TATAAGGTTTGAGCCAATGATTCGTTTCAACCGCCTTTTCGGCCTACTACTAAACGCATTCTTAATGCGCGGCAGGCTTGTGGGCGGAATCAATCACTGATTCAGACTTGCAAAACTAAGAAACCCGCGCCGATGCGCGGGTTTTTTT
Yersinia pestis KIM
y3644 null -238 116.5 AGAAGCTGAAATTTATGTTCTACTCAACCCGTCTACTAAGCCTACTACTTAACGCATCTCTCTTGCGCGGTATGTTGGTGGACGGAAATCAGAACTGATTCAGCCATCAAGATTAACAAGCCCGCGCAAATGCGCGGTTTTTTTTTG
Serratia proteamaculans 568
Spro_0745 leuA -190 97.3 TAGAGAGCTGAACCGCCATGAACTCTACTTTCCGTCTACTAGGCCTACTACTTAACGCATCTTGTTTGCGCGGTATGCCGGTGGACGCAGTTCAGAGCTGATTCAGCCCACCTCATAACAAACCCGCGCTACTGCGCGGGTTTTTTT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3831 leuA -195 119.9 GAGACACGACACTATGTTCAAGTTTACTGTCCTACTAAGCCTACTACTAAACGCATCCTTCTTGCGCGGTAGGTTTGTGGGCAGACTTCAGAACTAAGTTTCTCGCCACACGATACAAAAACCCGCGCTGATGCGCGGGTTTTTTTTT
Edwardsiella tarda EIB202
ETAE_0621 leuA -108 31.7 GCTAGAATTCACCCACAGACTCCACAAGCCCGCGCAATAGCGCGGGCTTTTTT
Proteus mirabilis HI4320
PMI2084 leuA -189 65.3 GTAAGGATGTTTCATGTTAAACGCAATTTTACTATCAAGCCTACTACTATTCGCAACATTGATGCGCGGTCGGCTGATGGGTAAAAAATGAAACATACCTACCCTTAGAGAAAAACCCGCGCTAATCGCGGGTTTTTTTAT
Photorhabdus luminescens subsp. laumondii TTO1
plu3673 leuA -194 51.2 TCGATATGATTCACTCAATTTGTCTACTAAACCTACTACTCATCGTATCTGATATGCGCGGTATGCTGGTGGACAGAAAACAGAGTTGATTCAAAACAGAGTTGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD