Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Leu_leader in Shewanellaceae

Properties
Regulator family: RF00512
Regulation mode:
Biological process: Branched-chain amino acid biosynthesis
Effector:
Regulog: Leu_leader - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_4236 leuA -111 24.1 TCGATAGATAGGCAAAACACTCATAAACCCCGCACTAATGTTGCGGGGTTTTTT
Shewanella putrefaciens CN-32
Sputcn32_0471 leuA -105 22.1 AAGAGGCAAAGCATTCACAAACCCCGCACAAATGTTGCGGGGTTTTTTGT
Shewanella sp W3-18-1
Sputw3181_0374 leuA -105 22.1 AAGAGGCAAAGCATTCACAAACCCCGCACAAATGTTGCGGGGTTTTTTGT
Shewanella sp ANA-3
Shewana3_3761 leuA -111 23.8 TCGATAGATAGGCAAAACACTCATAAACCCCGCACCAATGTTGCGGGGTTTTTT
Shewanella sp MR-4
Shewmr4_3588 leuA -111 21.9 TCGATAGATAGGCAAAGCATTCACAAACCCCGCACCAATGTTGCGGGGTTTTTT
Shewanella sp MR-7
Shewmr7_0368 leuA -109 21.9 GATAGATAGGCAAAGCATTCACAAACCCCGCACCAATGTTGCGGGGTTTTTTGT
Shewanella baltica OS155
Sbal_0386 leuA -105 21.8 AATAGGCAAAGCATTCACAAACCCCGCACCAATGTTGCGGGGTTTTTTGT
Shewanella denitrificans OS217
Sden_0334 leuA -173 17.6 GAAACACACTTACTTGCAACTCGGACTCCTTCTCCTCTCTGACATTTTTGTGCGGAGTGTGTGGTGTTGCAAGTAAAACAGCAAAATTAACACTAAACCCGCGCTAATCGTCGCGGGTTTTTTGTT
Shewanella frigidimarina NCIMB 400
Sfri_3820 leuA -212 29.9 ACATAATGAACACACAATCAGTTTTACTCGGACTCCTTCTCCTCTCACGCATATCCTGCGCGGAGTCCTTTGTGTTACATGCAAAATAATTCATTAAGCATACACAAACCCCGCGCTAATAGTCGCGGGGTTTTTT
Shewanella amazonensis SB2B
Sama_0335 leuA -110 20 GCTAGCCAAGCAAAGCCTTCACAAAACCCCGCGCCAACCACGCGGGGTTTTTTGT
Shewanella loihica PV-4
Shew_3472 leuA -134 20.6 GGAGAATGTAGTGTTGCACGCTTAATAACACACCCATCATTCATAAACCCCGCGCCCAACAACGCGGGGTTTTTT
Shewanella pealeana ATCC 700345
Spea_3828 leuA -136 17.7 GGAGGACTTAGTGCTATACGCTTTAAAATGAGCCTGCATTAATAAACCCCGCAAATAGAGCGGGGTTTTTT
Shewanella halifaxensis HAW-EB4
Shal_0438 leuA -212 19.3 GTGATGAAATATAACCGTGTATTACTAGGACTCCTTATTCTCATTCTCGCAGACTCTGCGCGGAGGACTTAGTGCTATACGCTTGAAAATAAGCCTGCATTAATAAACCCCGCTAATAACGCGGGGTTTTTTGT
Shewanella piezotolerans WP3
swp_2213 leuA -192 21.2 ACCATTTATGAAGCGTACAAGCACATTACTCATACTCCTCAGTCTCATTCTCGCAGTCACTGCGCGGAGGATATAGTGCTACACGCTTAAGAAAGCCTGCATTTATAAACCCCGCGAATAGTACGCGGGGTTTTTTGT
Shewanella sediminis HAW-EB3
Ssed_0393 leuA -194 20.8 ATGAAAATTAAAAGTGCATTACTCAACCTCCTCATTCTCATTCTCGCAGATTCTGCGCGGAGGATGTAGTGTTGCACGCTCGATAGAAGTACCAGCATTCACAAACCCCGCGCTAACAACCGCGGGGTTTTTTGT
Shewanella woodyi ATCC 51908
Swoo_4550 leuA -199 24.8 AGATGAATATTAGCCGTGCATTACTCAACCTCCTCATTCTCATTCTCGCAGTTTCTGCGCGGAGGATGTAGTGTTGCACGCTTGATTAGAGTCACCAACATTCAAAACCCCGCGCTACGAATCGCGGGGTTTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD