Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Cyanobacteria

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Synechococcus sp. JA-3-3Ab
CYA_2052 rplU -55 18.9 ATGCTCGGATCAGGTTGCAAGACCCCTAGGGGCACCTGTACGGCAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD