Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Bacillales

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU27960 rplU -90 57.2 ACCATTGCTACAACCGCTCAGTACAGGTGTTAAGAGCTTTTACAGCCCCCTGGTATCTGGCGAGTCTTAGTCTAATA
Bacillus amyloliquefaciens FZB42
RBAM_025010 rplU -88 56.8 ACCAATGCTACAACCGCTCGGGACAGGTGATAAGAGCTTTAAAGCCCCCTGTTGCTGGCGAGTCTTAGTCTAATA
Bacillus pumilus SAFR-032
BPUM_2436 rplU -86 55.8 ACCCGTGCTACAACCGCGCGAAGCAGGTGTAAAGAGCCTAAGGCCCCCTGTATTCGGCGAGTCTGAGTTTATTA
Bacillus licheniformis DSM 13
BLi02923 rplU -88 62 ACCCGTGCTACAACCGCTCAGCACAGGCGTTAAGTGCTTTCTTAGCCCCCTGTGACTGGCGAGTCTTAGTTTATTA
Anoxybacillus flavithermus WK1
Aflv_0694 rplU -41 56.7 CCGTGCTACAACCGCTCAGCTAAGGCTATTTAAGCGTTCGCTTGAACCGCCTCGCAGCTGGCGAGTCTGAGTCTAATTTA
Geobacillus kaustophilus HTA426
GK2610 rplU -95 53.8 ACCCGCACTACAACCGCTCAGCGCGGGCGATGAAGCGCTCCGTCTTGGGCCGCCTTGGCGCTGGCGAGTCTGAGTCCATGA
Bacillus cereus ATCC 14579
BC4438 rplU -93 58.1 CTATATGCTACAACCGCACAAGACAGGTTCCCTAAAGGCATTTATGTCTACCTCGTTTTTGGCGAGTCTTAGTAATTAA
Bacillus halodurans C-125
BH3011 rplU -86 64.1 CCAATGACTACAACCGCACAGACTAGGTTTATAAATGGATCTCCCTACCTAGAATGGCGAGTCTGAGTATATGA
Bacillus clausii KSM-K16
ABC2602 rplU -87 51.9 AATGAACTTACAACCGCGCAGATTAGGCGTTAAAATGGCATGTCCTGCCTATGATGGCGAGTCTGATGTTATGA
Oceanobacillus iheyensis HTE831
OB2046 rplU -137 35.8 GCCCGTGCTACAACCGCACAGAATAGGTGAGTGTAAAAAGCGTAAAACAGCATTCGTTGTTTTTTGCTTAACATTTTTAAAATCCGTATTGGATTACCTAAATGGCGAGTCTGAGTTGAATG
Paenibacillus sp. JDR-2
Pjdr2_4413 rplU -97 33.8 GGACATGCATGAACCGCTCCAATCGGGTATAAGCGCGGCAGCTTTTGCTGCAGCCACCTGGATTAGGCGAGTCTTCGACAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD