Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Thermotogales

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga neapolitana DSM 4359
CTN_1035 rplU -7 19.3 GCTTGAAGTGCGTCGAAAATCCCTTTTTGGGTACGTACTTCAGCGCC
Thermotoga lettingae TMO
Tlet_1979 rplU -95 23.8 AGTATTTACACAAGCACTCGAGAAACGTCTTTAAATGCTCCAAAGGGACTCCGGAGCTACGTTTTTTGGTGCCTGTTTACTAAGGA
Thermosipho africanus TCF52B
THA_1316 rplU -98 19.3 TCTTAGGTTATAGTCGCCTGGAACGTGTCTTAAACGCCGAAAAAAGGCTACATGTTCCAGCGGTTGTTTATTTCAAA
Thermosipho melanesiensis BI429
Tmel_1036 rplU -95 16.5 CTTAAGGTTATAGTCGCCTGGAACGTGTCTCAAACGCCAAAGGGCTACATGTTCCAGCGGTTGTTTATTTCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD