Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L21_leader in Staphylococcaceae

Properties
Regulator family: RF00559
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L21_leader - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus capitis SK14
STACA0001_2373 rplU -138 31.9 CATACAACCGCTCAAATACAGGTTTAAGTACGAAGGCAAATATATTATTTTGTTTGTCTATTCAAGCTAGCTTCATTGTATAGCTCATGAAGGTGTCACCTGTATATGGCGTGACTTATTATATAGGA
Staphylococcus epidermidis ATCC 12228
SE1330 rplU -90 56.4 AAGCTACATACAACCGCTCGCATACAGGTTGAAGTACAATCATATTGTCACCTGTATATGGCGTGACTTATTATATAG
Staphylococcus carnosus subsp. carnosus TM300
Sca_1258a rplU -92 53.8 TAGCTACATACAACCGCTCAAATATAGGTATAAGTATATTGATAAAATATCACCTATATATGGCGTGACTTATTATATAG
Staphylococcus haemolyticus JCSC1435
SH1273 rplU -90 55.2 GCTACATACAACCGCTCAAATATAGGTTTAAGAACATTTTTTTATGTCACCTATATATGGCGTGACTTATTAATATAGG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1112 rplU -86 52.6 GCTACATACAACCGCTCGGATTCAGGTTAAAGTACATGTATGTCACCTGAGTTTGGCGTGACTTAAATTATTAGG
Macrococcus caseolyticus JCSC5402
MCCL_1285 rplU -86 47.5 AAGCTACATACAACCGCACAACTTTAGGTTTAAGTGAGTAATCCACCTAAAGATGGCGTGACTTATAAATAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD