Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L20_leader in Bacillales

Properties
Regulator family: RF00558
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L20_leader - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU28870 infC -190 85.7 AAATCACAAGCAGAAGCACCCGCTTCTCACCTGATTGACACATGCATGTAGTTGGCAGGTTGACCGTACATTTTTATTGATACAGATGTTCGTAGTGTGGGTGTTTTATAATGCCCACACTTTTTGTTTGCC
Bacillus amyloliquefaciens FZB42
RBAM_025930 infC -208 81 AAATCACAAGCAGAGGCACCCGCTTCTCACCTGATTGACACATTCATGTAGTTGGCAGGTTGACCGTACATTTTTATTTATGCAGATGTTCGTAGTGTGGGTGTGTTGTCATGCCCGCACTTTTTGTTTGCC
Bacillus licheniformis DSM 13
BLi03035 infC -84 79.9 TATCAACAAGCAGAAGCACCCGCTTCTCACCTGATTGACACATTCTTGTAGTTGGCAGGTTAAACGTACATTTCTTATTTTTCTATGCAATGTTCGCAGTGTGGGTGTTTCGATGCCCGCACTTTTTGTTTGCC
Anoxybacillus flavithermus WK1
Aflv_0522 infC -148 72.9 GAAACAAGCAGAAGCACCCGCTTCTCACCTGATGGACGCCGTAGGGCTGTTAACAGGTTCATGACAAAACAAATGTTGTGAGTGAGACGTGTGGGTGTGTTGTGCCCACACGTTTTTTGTTGTGT
Bacillus cereus ATCC 14579
BC4575 infC -185 88.8 GTGGAACAAGTAGAAGCACCCGCTTCTCACCTGATGGACGCATTCGCAGTTAACAGGTAAATGTATTTCTTACTTAAGATTTTACAAGTGTGGGTGTCGTATGCCCGCACTTTTTTTGTTCG
Bacillus halodurans C-125
BH3140 infC -156 74.5 TCAAAGCAAGAAGGAGCGCCCGCTTCTCACCTGATCGACGCACAGCGCAGTTGACAGGTCTACATGTAATAATGTCTCATGATGACAAACATGAGTGTGGGCGTCGTATGCCCACACTCTTTTGTGTTG
Bacillus clausii KSM-K16
ABC2689 infC -187 80.7 ATAGAGCAAGAAGAAGCGCCCGCTTCTCACCTGTACGACATTGGTTGCCAGGTTAGAAACCGTCAGTTTGTTAAAATGCTGATTAAGTGTGGGTGCCGTGCGTCCACACTTTTTTCACGTT
Oceanobacillus iheyensis HTE831
OB2152 infC -197 80 CTAAGACAAGTAGAAGCACCCGCTTCTCACCTGATTGACACCGATTATGGTAGTTGACTGGTTCCAACCTTTTATTTAAATGTATTTGGAGATGTGTGGGTGCGTGTATGTACCGACACTTTTTTAATTGC
Paenibacillus sp. JDR-2
Pjdr2_1288 infC -134 39.4 TGCACAAGCAGAAGCACCCGCTTCTCACCTTTCGGTTATGCCGACTGGTTTGCGATAACTGACTAGCTTAACGAGTTGCTTCCCTGGGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD